ID: 948632812

View in Genome Browser
Species Human (GRCh38)
Location 2:239312872-239312894
Sequence CTTCATCTGCAGAGGGAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 351}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948632805_948632812 -6 Left 948632805 2:239312855-239312877 CCACGTTCCCCCAGTGTCTTCAT 0: 1
1: 0
2: 1
3: 27
4: 274
Right 948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG 0: 1
1: 0
2: 4
3: 45
4: 351
948632804_948632812 13 Left 948632804 2:239312836-239312858 CCTGCTGACTGTGGGTAGGCCAC 0: 1
1: 0
2: 1
3: 11
4: 166
Right 948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG 0: 1
1: 0
2: 4
3: 45
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948632812 Original CRISPR CTTCATCTGCAGAGGGAGAC CGG Intronic
900031141 1:373914-373936 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
900051708 1:602163-602185 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
900475865 1:2876065-2876087 CTGCATCCGCAGAGGGAGTTGGG + Intergenic
900959154 1:5908342-5908364 TGTCATCTGCAGTGGGAAACTGG - Intronic
904004592 1:27357109-27357131 CTTCACCTGCAGGGGGAGGGAGG + Exonic
904005164 1:27359813-27359835 CCTCATCTGCTGAGGGTGGCGGG - Intronic
904917846 1:33983148-33983170 GGCCCTCTGCAGAGGGAGACTGG + Intronic
905277951 1:36831158-36831180 CTTGCTCTTCAGAGTGAGACAGG - Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906688701 1:47778782-47778804 CCTCATCTGCAAAGTGAGAATGG + Intronic
907326351 1:53640982-53641004 CTTCAAAAGCACAGGGAGACAGG + Intronic
907573234 1:55503352-55503374 TTTCAACTGCTGAGGGAGAGGGG + Intergenic
908186714 1:61659290-61659312 TTTCATCACTAGAGGGAGACAGG - Intergenic
908654402 1:66372681-66372703 GTTCATCTCCACAGGGAGAGGGG - Exonic
911164721 1:94714365-94714387 CTCCCTCAGCAGAGGGAGACTGG - Intergenic
911256390 1:95638181-95638203 CTACACTTGAAGAGGGAGACAGG + Intergenic
911569620 1:99507599-99507621 CTTCAGCAACAGAGGGAGAGGGG - Intergenic
911945889 1:104108392-104108414 CTTCTTCTTCACAGGGTGACAGG - Intergenic
912503485 1:110138082-110138104 CTTCCTCTGCAGAGGCGGACCGG - Intergenic
912828161 1:112925199-112925221 CTCCAGCCACAGAGGGAGACTGG - Intronic
912872432 1:113321502-113321524 CTTCTTCTGAAGAGGCAAACAGG - Intergenic
913126142 1:115792190-115792212 CTTCATCAGCAGCTGGAGGCAGG - Intergenic
916252995 1:162756543-162756565 CTGCATCTGCAAAGTGAGCCTGG + Intronic
918821835 1:189266541-189266563 ATTCTTCTGCAGAGAGAGAATGG - Intergenic
920349696 1:205329655-205329677 TTCCATCTGTAGAAGGAGACTGG - Intergenic
920376040 1:205508548-205508570 CTACATCTGCAGAGGAGGAGGGG + Intronic
920734852 1:208524016-208524038 CTGCATCTTCAGAGTGAGTCAGG - Intergenic
920916476 1:210261951-210261973 CTTCATCTGATAGGGGAGACTGG - Intergenic
922421715 1:225464996-225465018 GTTCAGCTGCAGAGGGAGGCTGG + Intergenic
923139069 1:231145430-231145452 ATTCATCTGTAGATGGACACAGG - Intergenic
923229546 1:231972083-231972105 GTTCATTTGCAAAGTGAGACCGG - Intronic
923234446 1:232019110-232019132 CATCATCTGGTGAGGGAGACAGG + Intronic
924811699 1:247408479-247408501 ATTCATCTGTTGCGGGAGACTGG + Intergenic
1062909168 10:1201251-1201273 CTGCATTTGCAGAGGGAGAGAGG - Intronic
1064147319 10:12835808-12835830 CTGCTGCTGCAGAGGGGGACTGG + Intergenic
1064399799 10:15012037-15012059 CCTCATCTCCAGAGGAAGAGGGG + Intergenic
1067708972 10:48633767-48633789 ATCCATCTGCAGAAGGAGATGGG + Intronic
1067709548 10:48637178-48637200 CTGAAGCTGCAGATGGAGACAGG + Intronic
1068572955 10:58651208-58651230 CTTCCTCTGCACAGTGAGATGGG + Intronic
1068781879 10:60928422-60928444 ATTCATCTGCTGATGGACACAGG - Intronic
1069591596 10:69645367-69645389 CCTCATCTGCAGAGGCAAACAGG + Intergenic
1070722822 10:78768390-78768412 TTACATCTGGAGAGGGAGACGGG + Intergenic
1071717669 10:88113591-88113613 CTCCATCTACTGAGGGACACAGG + Intergenic
1072756751 10:98026633-98026655 CTTCATCTTCAGCGGGAGGAGGG - Intronic
1072828725 10:98635474-98635496 GTTCATCTGTTGATGGAGACAGG - Intronic
1073024844 10:100480350-100480372 CTTCCTCAGCAGAGAGATACTGG + Intronic
1073841916 10:107507407-107507429 CTTCATCTGGTGAGGGTGTCGGG - Intergenic
1074355610 10:112780844-112780866 CTTTATCTGTAGAGGAACACTGG - Intronic
1075044507 10:119135360-119135382 ATTCATCTGCTGAAGGACACTGG - Intronic
1075942468 10:126403327-126403349 CTTCATATTCACAGGGATACTGG + Intergenic
1076646276 10:131957205-131957227 CTTCATCTCCACAGGCGGACGGG - Intronic
1076646286 10:131957279-131957301 CTTCATCTAGACAGGGTGACGGG - Intronic
1076646334 10:131957505-131957527 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646344 10:131957542-131957564 CTTCATCTCCACAGGGGCACGGG - Intronic
1076646353 10:131957579-131957601 CTTCATCTCCACAGGGAGATGGG - Intronic
1076646360 10:131957615-131957637 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646371 10:131957652-131957674 CTTCATCTCCACAGTGGGACAGG - Intronic
1076646380 10:131957689-131957711 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646390 10:131957726-131957748 CTTCATCTCCACAGGGAGATGGG - Intronic
1076646410 10:131957799-131957821 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646439 10:131957906-131957928 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646448 10:131957943-131957965 CTTCATCTTCACAGGGAGATGGG - Intronic
1076646468 10:131958017-131958039 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646489 10:131958091-131958113 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646498 10:131958127-131958149 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646533 10:131958277-131958299 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646543 10:131958314-131958336 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646555 10:131958351-131958373 CTTCATCTCCACAGGAAGACGGG - Intronic
1076646581 10:131958462-131958484 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646593 10:131958499-131958521 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646603 10:131958536-131958558 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646617 10:131958573-131958595 CTTCATCCCCACAGGGGGACAGG - Intronic
1076646633 10:131958647-131958669 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646642 10:131958684-131958706 CTTCATCTCCACAGGAGGACGGG - Intronic
1076646659 10:131958758-131958780 CTCCATCTCCACAGGGGGACGGG - Intronic
1076646670 10:131958795-131958817 CTCCATCTCCACAGGGGGACGGG - Intronic
1076646680 10:131958832-131958854 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646706 10:131958943-131958965 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646722 10:131959017-131959039 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646732 10:131959054-131959076 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646748 10:131959128-131959150 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646759 10:131959165-131959187 CTTCATCTCCACAGGGGGACCGG - Intronic
1076646768 10:131959202-131959224 CTTCATCTCCACAGGAGGACGGG - Intronic
1076646776 10:131959239-131959261 CTTCATCTCCACAGGGGGACGGG - Intronic
1076646802 10:131959350-131959372 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646818 10:131959424-131959446 CTTCATCTCCACAGGGGGATGGG - Intronic
1076646829 10:131959461-131959483 CTTCATCTCCACAGGGGGACCGG - Intronic
1076740300 10:132479530-132479552 CTTCCTCTGCAGTGCGAGGCGGG - Intergenic
1077231325 11:1459333-1459355 CTACATCTACACAGGGAGGCCGG - Intronic
1077245183 11:1533480-1533502 CTTCCTCTGGAGAGGGGGTCTGG + Intergenic
1078186969 11:9060380-9060402 CTTCACCTCCCCAGGGAGACTGG - Intronic
1078206587 11:9235226-9235248 CTTCATCTGTTGATGGACACTGG - Intronic
1079289051 11:19169869-19169891 CTAAATCTGCAGAGGAAGAAAGG - Intronic
1079542039 11:21588134-21588156 CTTAATCCTCAGAGGGAGACTGG - Intergenic
1079613989 11:22467940-22467962 CACCATCTGCACAAGGAGACAGG + Intergenic
1081699529 11:45144392-45144414 CTGCATCTGTAGGGTGAGACTGG - Intronic
1082259971 11:50071325-50071347 TTTCACCTGTAGAGGCAGACGGG + Intergenic
1082271255 11:50171335-50171357 CTTCATCTGGAAAGGAAGACAGG + Intergenic
1083163383 11:60869128-60869150 ATTCATCTGCAGTGGGGGAAGGG - Exonic
1083174671 11:60942140-60942162 CTGCATCTGCCAAGAGAGACAGG + Exonic
1083277878 11:61607461-61607483 TTCCCTCTGCAGAGGGAAACTGG - Intergenic
1084269902 11:68023166-68023188 CTTAAGCTGCAGAGGCAGCCTGG + Intronic
1084525750 11:69697065-69697087 CTTGATTGGCAGATGGAGACAGG + Intergenic
1084735287 11:71101539-71101561 CTCCATCTGCAGAGGGTGAGAGG - Intronic
1085091415 11:73718151-73718173 CTTCCTCTACAGAGAGAGAATGG + Intronic
1085567415 11:77526958-77526980 CTTTTTCTGGAGAGTGAGACTGG + Intronic
1086449091 11:86898704-86898726 CTCCATCAGCAGAGGGTGATGGG + Intronic
1088230494 11:107669251-107669273 CTTCCTCTCCTGGGGGAGACAGG - Intergenic
1088834271 11:113564540-113564562 CTGCATGTGAAGAGGGACACTGG + Intergenic
1088987441 11:114922101-114922123 CTGCATATGCTGAGGGAGAGAGG - Intergenic
1089075442 11:115734755-115734777 CTTCCTCTGCAGGGGAAGGCAGG + Intergenic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1091459976 12:636981-637003 ATTCATCTGCTGATGGACACTGG - Intronic
1092034655 12:5322361-5322383 CATCATCTGTTGAGGGACACAGG - Intergenic
1094587913 12:31794839-31794861 CTTCAGCTGGAGTGGGAGAGGGG - Intergenic
1096506843 12:52099080-52099102 CCTCATATCCAGAGGGAGAGAGG - Intergenic
1100744349 12:97629108-97629130 CCTCATTTGCAAAAGGAGACTGG - Intergenic
1101136341 12:101747654-101747676 CTTCATCTGTAGGAGGAGGCAGG + Intronic
1101914437 12:108885243-108885265 CTAAGTCTGCAGAGGGAGTCAGG + Intronic
1102352999 12:112208529-112208551 CATCATCTGCAATGGGAGGCGGG + Exonic
1102701992 12:114847478-114847500 CCCCATCTTCAGAGGCAGACCGG + Intergenic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1103038465 12:117675364-117675386 CCTGATTTGCAGATGGAGACTGG - Intronic
1103362920 12:120364270-120364292 CTGCCTCTGCAAAGGGTGACTGG + Intronic
1104104248 12:125644197-125644219 CTCAATCTGCAGGGGGAGCCTGG - Exonic
1104678050 12:130729231-130729253 TCTCACCTGCAGAGGGAGACCGG - Intergenic
1105822040 13:24088413-24088435 CTTCATCTCAAGAGGAAGAAAGG - Intronic
1106110175 13:26770353-26770375 CTTCACTTGCACAGGGAGACAGG - Intergenic
1106750200 13:32756349-32756371 CTTCCTCTGTAGAAGGAGAATGG + Intronic
1106879376 13:34112760-34112782 GTTCATCTGCTCATGGAGACTGG - Intergenic
1106881606 13:34138070-34138092 CCTCATCAGCAGAGGCAGACAGG - Intergenic
1106881702 13:34138908-34138930 CCTCATCAGCAGAGGCAGAGAGG - Intergenic
1107175578 13:37394862-37394884 CTGCAGCTGCAGTGGGAGAGAGG - Intergenic
1107465754 13:40648601-40648623 CTCCTTCGGCAGAGGAAGACAGG - Intronic
1107737879 13:43417181-43417203 CCTCAGCAACAGAGGGAGACGGG + Intronic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1113232333 13:108226550-108226572 TTTTATCTGAAGAGGGAGAAAGG + Intronic
1115544474 14:34453355-34453377 CTTTCTCTGAAGAGGGAGACTGG - Intronic
1116763673 14:49045308-49045330 CTTCCTCTGCATTGGGAGAGGGG + Intergenic
1117986379 14:61389953-61389975 TTTCATCTGAAGAGGAAGACTGG - Intronic
1118290028 14:64511320-64511342 CTGCTTCTGGAGAGGGAGAGAGG + Exonic
1118668575 14:68098418-68098440 CTTTATCAGCAGAGTGAAACTGG - Intronic
1119712327 14:76831186-76831208 CATCATCTGCAGAGAAAGATGGG - Exonic
1120132237 14:80821809-80821831 CTTTATCTGCAGTGGGAGAATGG - Intronic
1120249081 14:82040211-82040233 CTTAAACTGCATAGGGACACTGG + Intergenic
1120715880 14:87840293-87840315 CTGTAACTGCAGAGGGAGACTGG - Intronic
1121278851 14:92685943-92685965 CTTCATATGCAGAGGATGATAGG - Intronic
1121323350 14:93005654-93005676 CTGCTTCTGCAGAGAGAAACCGG + Intronic
1122257286 14:100488192-100488214 CTTCATCTCCAGAGGTCGGCAGG + Intronic
1122268848 14:100559285-100559307 CATCTTCTCCAGAGGGAGAGAGG - Intronic
1123831750 15:24146233-24146255 CTTCTTCAGGAGAGAGAGACAGG + Intergenic
1124425412 15:29558669-29558691 TTTCAACTGCAGAGGGAGTCAGG - Intronic
1125464774 15:39940203-39940225 CATCACCTTCAGAGGGAGTCTGG - Intronic
1126458246 15:48888212-48888234 ATTCATCTGTAGATGGACACCGG - Intronic
1127631997 15:60836271-60836293 CTTTATGTGCAGATGGAGAGAGG + Intronic
1128390684 15:67180589-67180611 CATCATCTGCAGACTGAGCCTGG - Intronic
1128555296 15:68627643-68627665 CTTCATCTGCAGGATGGGACGGG + Intronic
1128698802 15:69788976-69788998 TTCCATCTGCAAAGGGAGGCGGG + Intergenic
1128785809 15:70396052-70396074 CTCTATTAGCAGAGGGAGACGGG + Intergenic
1128945109 15:71814499-71814521 CATCATTTGCAAAGGGAGAGAGG + Intronic
1129521996 15:76191951-76191973 CTCAAACTGCGGAGGGAGACGGG - Exonic
1129669934 15:77601967-77601989 CTCCTTCTGCAGAGAGGGACAGG + Intergenic
1129940818 15:79495330-79495352 CATCATTTGCTGAGAGAGACAGG + Intergenic
1131250499 15:90827181-90827203 CTTCGTGTGCAGTGGGAGCCTGG + Intergenic
1131551724 15:93363047-93363069 CTTCATGTCCAGCAGGAGACAGG + Intergenic
1132327100 15:100981055-100981077 CATCCTTTGCAGAGGGCGACTGG + Intronic
1134473222 16:14547209-14547231 CTTCATCTGAAGAGCCAGAGGGG + Intronic
1134740699 16:16541231-16541253 TTGCATCTGTAGAGGAAGACAGG + Intergenic
1134859247 16:17546342-17546364 CTTCATCTGCAGAAGTAGACGGG - Intergenic
1134926804 16:18170949-18170971 TTGCATCTGTAGAGGAAGACAGG - Intergenic
1135751891 16:25065026-25065048 TTTCATCTGCGGAAGCAGACAGG - Intergenic
1135960610 16:26991699-26991721 CTGCAACTGCCGAGGGAGAAGGG + Intergenic
1138783682 16:59820258-59820280 CTTCATCTGTTGATGGACACAGG - Intergenic
1140599071 16:76453016-76453038 CTTTGTCTGGAGTGGGAGACAGG - Intronic
1141888953 16:86913684-86913706 CTTCATATGAAGAGGGAGGGTGG - Intergenic
1142107389 16:88311920-88311942 CTTCATCAGCAGTGTGAGAATGG - Intergenic
1143057335 17:4172106-4172128 CTTCTTATGCAGAGGGCTACAGG - Intronic
1143496020 17:7313041-7313063 CTGCATCTGCACAGGGAGCTGGG + Exonic
1145249315 17:21288681-21288703 CCTCATCTGCAGACTGAGAATGG + Intronic
1147976565 17:44251327-44251349 CTTCACCTGCAGGCGGAGGCTGG + Exonic
1151372261 17:73655724-73655746 CTTCATCTTCACAGAGATACTGG + Intergenic
1151962626 17:77415046-77415068 CTTCATCAGCTGAGGGACATTGG + Intronic
1152604159 17:81280728-81280750 CACGATCTGCAGAGGGAGAGGGG + Exonic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152737471 17:82004486-82004508 CTTCACCTGCAGGAGGAGTCGGG + Intronic
1152798979 17:82322365-82322387 CTTCTTCTGCAGGGGGAGGAAGG + Exonic
1152948512 17:83211799-83211821 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1153791688 18:8584890-8584912 TTTCATCTGCAGAGCGGGACGGG - Intergenic
1154083585 18:11280853-11280875 CTGCATCTGCAGAGGAAGTGCGG + Intergenic
1155071403 18:22320135-22320157 CTGCACCTGCAGAGTGAGGCAGG + Intergenic
1158305018 18:56095696-56095718 CTTCATGAGCAAAGGGAGAATGG - Intergenic
1158661296 18:59390620-59390642 CTTCATCTTCAGAGGAAGTATGG + Intergenic
1158817507 18:61120225-61120247 CTTCATCTGTGGATGGACACAGG + Intergenic
1159129953 18:64270127-64270149 TTTGATCTGAAGAGGGAAACAGG + Intergenic
1160153725 18:76415728-76415750 CTTCAACTGCATAGAGAAACCGG + Intronic
1160842897 19:1154397-1154419 CATGATCTGCAGAGGGAGACGGG + Exonic
1161251730 19:3284503-3284525 ACTCATGTGGAGAGGGAGACGGG + Intronic
1161322145 19:3646234-3646256 CTCCCTCTGGGGAGGGAGACTGG + Intronic
1162572573 19:11481532-11481554 AGTCTTCTGCAGAAGGAGACTGG + Intronic
1163647070 19:18495562-18495584 CTTCAGCTGCAGTGGGAGCTGGG - Intronic
1163749978 19:19070917-19070939 CTCCACCTTCCGAGGGAGACAGG - Intronic
1164541165 19:29122501-29122523 CTTCTTCTCCAGAAGGAGAGGGG - Intergenic
1165740626 19:38203294-38203316 CTGCAGCTGCAGAGGGAGATGGG - Intronic
1166109745 19:40614659-40614681 CTTCAGCTGCAGAGGGGGAATGG - Intronic
1166345272 19:42161745-42161767 CTTCATCTTCAGGGGCAGAAGGG + Intronic
1166729674 19:45052054-45052076 CTTCTTCTGCAGGGGTAAACAGG - Exonic
1166885965 19:45961051-45961073 GTGCAGCTGCAGAAGGAGACCGG - Exonic
1167528981 19:50003057-50003079 CTTCATCTGCAGAGGGGAGATGG - Intronic
1167722502 19:51187961-51187983 TTTCAGCTGTAGAGGAAGACAGG - Intergenic
925185222 2:1842449-1842471 CTTCCTGTGAAGAGCGAGACAGG - Intronic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
926705978 2:15837885-15837907 GTTCAACTGCAGGTGGAGACAGG - Intergenic
926758323 2:16253488-16253510 CCTCATCAGCAGGTGGAGACCGG + Intergenic
929608724 2:43253961-43253983 CTGGGTCTCCAGAGGGAGACTGG - Intronic
929865228 2:45711979-45712001 TTTCATCTGCAGAGTGAAATAGG - Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930173886 2:48281498-48281520 CCTCATGTGCTCAGGGAGACAGG - Intergenic
936588596 2:113781132-113781154 ATTCATCTGTTGATGGAGACAGG - Intergenic
937435913 2:121881166-121881188 CTTCATCTGCAGATGGGCATGGG - Intergenic
938066360 2:128283988-128284010 TTTCACCTGCCGAGGGACACAGG + Intronic
938228986 2:129641562-129641584 GTCCACCTGCAGAGGGAGAGGGG - Intergenic
938337442 2:130511980-130512002 CCTCCTCTGCTGAGGGAGCCAGG - Intergenic
938352396 2:130608755-130608777 CCTCCTCTGCTGAGGGAGCCAGG + Intergenic
940307609 2:152243368-152243390 CTTCTTTTAAAGAGGGAGACTGG - Intergenic
945437271 2:209833312-209833334 CTTCATGAGCAGAGAGAGAGGGG + Intronic
945468756 2:210202490-210202512 CTTCATTTGCACAGGAAGAAAGG - Intronic
946664087 2:222031283-222031305 CTACATGTGCTGGGGGAGACAGG - Intergenic
948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG + Intronic
1168889623 20:1286402-1286424 CTGCAGCTGGAGAGGGAGAAGGG + Intronic
1169020969 20:2330542-2330564 AGTCATCTGCAGAGGCAGAGAGG - Intronic
1169470297 20:5879247-5879269 TTTCATCTGCATAGTAAGACAGG + Intergenic
1172998421 20:39088320-39088342 TTCCAGCTGCAGAGGGAGAAGGG - Intergenic
1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG + Intronic
1173727663 20:45308486-45308508 ATTCAGCTACAGCGGGAGACTGG + Intronic
1174056464 20:47801850-47801872 CTCCATCTGCAGAGGGGTAGGGG + Intergenic
1174269057 20:49353735-49353757 TTGCCTCTGCAGAGGGAAACTGG + Intergenic
1174677420 20:52371881-52371903 CTGCCTGTGCAGTGGGAGACTGG - Intergenic
1175962729 20:62645338-62645360 CTTCCTCTGCAGAGGCCCACAGG - Intronic
1176412689 21:6457531-6457553 CTTCAAGTGCAGGGGGAGAGAGG + Intergenic
1178758138 21:35372656-35372678 CATCCTCTGCAGAGGGGAACAGG + Intronic
1178978107 21:37237983-37238005 CTTAACCAGCAGAGGTAGACAGG + Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179688183 21:43065853-43065875 CTTCAAGTGCAGGGGGAGAGAGG + Intronic
1180032836 21:45224030-45224052 CTGCACCTGCAGAAGGAGAGGGG + Exonic
1180106595 21:45622858-45622880 CCTCATCTGCAGGAGGACACTGG - Intergenic
1181422815 22:22813660-22813682 TGTCATCTGCAAAGAGAGACGGG - Intronic
1181437933 22:22921198-22921220 CTTCACCCCCAGAGGGAGAGGGG - Intergenic
1182283407 22:29231003-29231025 GGTCATCTGAAGAGGAAGACAGG - Exonic
1183012544 22:34958762-34958784 CTTCATGTGCAGAGAGAAAGTGG + Intergenic
1183273298 22:36875519-36875541 CTTCTTCTGTAGAGGGAGGAGGG - Intronic
1183488515 22:38104039-38104061 CTTCACCTTCAGAGGATGACAGG + Intronic
1183663192 22:39233514-39233536 CTTCTCCTGCAGAGGAAGATGGG - Exonic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184457324 22:44618569-44618591 CTCCAGGTGCAGAGGGAGAAGGG + Intergenic
1184481191 22:44748358-44748380 CTTCATCAGCAGCGTGAGAATGG + Intronic
1184964750 22:47963113-47963135 TTTCATCTGCAGAGGGGTAAGGG + Intergenic
1185034849 22:48468397-48468419 CTGCCTCTGCAGAGGGTGAATGG + Intergenic
1185153633 22:49180321-49180343 CCACATGTGCAGAGGGAGCCTGG - Intergenic
1185296272 22:50056882-50056904 CTTCTTCTTCAGATGGAGACGGG - Exonic
949220517 3:1628085-1628107 ATTAATGGGCAGAGGGAGACAGG - Intergenic
949723652 3:7019065-7019087 CTTCCTCTGGAGAGGGAGGCTGG - Intronic
949884908 3:8685054-8685076 CCTCATATCCAGAGGGAGAGAGG - Intronic
950555855 3:13695584-13695606 CTTCAAGGGGAGAGGGAGACAGG + Intergenic
950698895 3:14726412-14726434 CATCCACTGCAGAGGGAGGCCGG + Intronic
952778798 3:37072877-37072899 CTTCTCCTGCAGAGGAAGAGGGG + Exonic
953017785 3:39094913-39094935 CTTAATCTACACATGGAGACTGG - Exonic
953330014 3:42044683-42044705 CTCCATCTGCATGGGGAGAAGGG + Intronic
953386256 3:42507673-42507695 CTTTATTTGCAGAGGAACACAGG - Intronic
955800430 3:62680691-62680713 CTTCATGGACAGTGGGAGACAGG - Intronic
956126587 3:66016746-66016768 CTTCATCTGTTGATGGAGATTGG - Intronic
956708558 3:72020520-72020542 CTGCAGCTGCATAGGGACACAGG + Intergenic
957044055 3:75360615-75360637 CCTCATATTCAGAGGGAGAGAGG + Intergenic
960459429 3:117914950-117914972 CTTCATCTGCAGCCGGGGATGGG + Intergenic
961580202 3:127874724-127874746 CTTCATCTGCAGAGGAAGCCAGG + Intergenic
962210287 3:133471898-133471920 TTTCAGCAGCAGAGGGAGAAGGG + Intronic
962400098 3:135050997-135051019 CTTCTCCTGCAGAGAGAGAGGGG + Intronic
962684976 3:137838481-137838503 CTCCATCAGCATAGGTAGACTGG + Intergenic
963618669 3:147576341-147576363 CTGCATCTGCAGGGGTAGAAGGG + Intergenic
964891331 3:161539447-161539469 ATTCATCTGCCGATGGACACTGG + Intergenic
965384006 3:168024192-168024214 CTCAATGTGCAGAGGGAGAGAGG + Intronic
966361820 3:179137803-179137825 CTTCAGCTGCAGTGGCAGAGTGG - Intergenic
966779230 3:183569363-183569385 ATTCATCTGCTGATGGACACAGG + Intergenic
966983258 3:185156636-185156658 CTTAATCTGAAGAGGTAGATGGG - Intergenic
967604201 3:191424925-191424947 CTGCATCTGCCGTGGGAGTCTGG + Intergenic
968478863 4:825358-825380 CTTCCTCTGCGGAGGGCGAGGGG - Intronic
968646587 4:1744165-1744187 GCTCAGCTCCAGAGGGAGACGGG + Intronic
968867926 4:3225615-3225637 CTTGATCTGCACAGGGGGGCAGG - Intronic
969134390 4:5018830-5018852 CCTCATCTGCTGAGGGACCCGGG - Intronic
969453721 4:7289214-7289236 CTCCATCTGCAGAGGGCCACAGG - Intronic
971134674 4:23855253-23855275 CTTTAGCAGCAGAGTGAGACTGG + Intronic
971635365 4:29049819-29049841 GATCATCTGCAGAGGGAGCGGGG + Intergenic
972232588 4:37093010-37093032 CTCCATGTGTAGAGGGAGAGGGG + Intergenic
972436359 4:39039292-39039314 CTTCATATGCAGGGGGAGGGTGG + Intergenic
972834480 4:42853273-42853295 CTACATCTCCAGTGGGGGACAGG + Intergenic
974356514 4:60819982-60820004 CGTCATCAGGAGAGGGAGAGTGG - Intergenic
977464684 4:97369066-97369088 ATTCATCTGTAGATGGACACTGG + Intronic
978605814 4:110477594-110477616 CTTCATCTGGAAAGGAAGACAGG + Intronic
979943883 4:126800258-126800280 CTTCAGCTGCAGAGGGCATCAGG + Intergenic
981152731 4:141397924-141397946 CTCCAACAGCAGAGGGAGAAGGG - Intergenic
984499572 4:180542187-180542209 TTTTATCTGCAGTGGGAGAAAGG - Intergenic
984657195 4:182330928-182330950 TCTCATCTGAAGAGGGAGAGTGG + Intronic
984747331 4:183234436-183234458 CTTCATTTCCAGTGGGATACAGG + Intronic
985589986 5:759599-759621 GTTCTTCTGCAAAGGGAAACAGG - Intronic
985814246 5:2114844-2114866 AATGATCTGCAGAGGGAGGCAGG - Intergenic
987905817 5:24075698-24075720 CTGCATGTGCAGAGAGAGAATGG + Intronic
990978521 5:61580241-61580263 CTGCAGCTGCAGAGAGAGGCAGG + Intergenic
991362506 5:65835687-65835709 CTTCCTCTGATGAGGGAGAAAGG + Intronic
993575336 5:89592534-89592556 CTTGCTCTGCAGAGGGAAATAGG - Intergenic
995835360 5:116395164-116395186 CTGCTTCTTCAGAGGGAGAGGGG - Intronic
997735491 5:136209737-136209759 CTTCATTTGCGGAGGCAGGCAGG - Intergenic
999174494 5:149622229-149622251 CTTCACTAACAGAGGGAGACTGG - Intronic
999419328 5:151427395-151427417 CTCCACCAGCAGAGGGTGACAGG + Intergenic
999874590 5:155788757-155788779 CTTTATTTGCAGAGGCAGATAGG + Intergenic
1001058551 5:168468990-168469012 CGTCATCTGCAGAGAGAGCTGGG - Exonic
1001885922 5:175290171-175290193 CTTTATCTGCAGTGGAAGCCTGG - Intergenic
1002742679 5:181444954-181444976 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1003178902 6:3775365-3775387 CTTCCTCTGCTGAGGGCCACAGG + Intergenic
1003706913 6:8542871-8542893 TGTCATCTGAAGTGGGAGACAGG - Intergenic
1004154156 6:13152391-13152413 ATTCATATGGAAAGGGAGACTGG + Intronic
1004808680 6:19234161-19234183 CTTAATCTGCAGAGGGAAGGGGG + Intergenic
1006256326 6:32835471-32835493 CTTCACTTGCAGAGGGACAGTGG + Intronic
1007589401 6:43012354-43012376 CTTGATGTGGAAAGGGAGACGGG + Exonic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1009047610 6:58248847-58248869 CATAATATGCAGAGGGAGAGAGG + Intergenic
1009242038 6:61195722-61195744 ATTCCTCTGCAGAGAGAGAATGG - Intergenic
1011787360 6:90862123-90862145 CTTCATATGCAGAGTGAAAAAGG - Intergenic
1012413596 6:98988143-98988165 CTTCATCTCATGAGAGAGACAGG + Intergenic
1017224097 6:152000175-152000197 CTTCATCTGCAAAATGAGAATGG - Intronic
1018818506 6:167354592-167354614 CTGCATCTGCAGATAGATACAGG - Intronic
1019127354 6:169849635-169849657 CTTCATCTGCCCAGGTGGACAGG - Intergenic
1019247814 6:170720693-170720715 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1020306681 7:6841111-6841133 CCTCATATCCAGAGGGAGAGAGG + Intergenic
1021840157 7:24715887-24715909 CTTCATTTGCAGAATGAGAGAGG + Intronic
1021959019 7:25853962-25853984 CGGTATTTGCAGAGGGAGACGGG - Intergenic
1022019728 7:26386701-26386723 CTTTATTTGAGGAGGGAGACAGG + Intergenic
1022237002 7:28471691-28471713 GATCATCTGCAGAGTGAGGCAGG + Intronic
1022470456 7:30678951-30678973 CACCATCTGGAGAGGGAGCCTGG - Intronic
1023301405 7:38776038-38776060 CCTCAGCTTCAAAGGGAGACTGG + Intronic
1023485979 7:40687280-40687302 CTTCATTGGCAGAAGGGGACAGG + Intronic
1024176333 7:46844628-46844650 CAACATCTGCAGAGGGAGCATGG - Intergenic
1024242247 7:47444640-47444662 CCTCAGCTGCAGAGTGAGAAGGG + Intronic
1024283848 7:47740134-47740156 CCTCCTCTGCAGAGGGGGCCTGG + Intronic
1025236531 7:57238311-57238333 CTCCATCTGCAGAGGGGTAGGGG - Intergenic
1027996915 7:85435690-85435712 CTTTATCAGCAGAGGGAAAATGG + Intergenic
1029865202 7:103620326-103620348 CTTCATCAGCAGCGTGAGAATGG + Intronic
1034949720 7:155288911-155288933 CTTCATCTTCAGAGAGTGACTGG + Intergenic
1035500303 8:87171-87193 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
1035557603 8:578482-578504 CTTCACCTGCCGAGGGACAGGGG - Intergenic
1036029003 8:4945000-4945022 ATTCATCTGCCAAGGGACACGGG - Intronic
1036240146 8:7074373-7074395 CCTAATCTCCAGAGGGAGAGAGG - Intergenic
1036772458 8:11588538-11588560 CTCCGTCTCCTGAGGGAGACCGG + Intergenic
1037715634 8:21395206-21395228 CTTCATCTGCATAGTGATACAGG - Intergenic
1037728895 8:21506956-21506978 TTTCCTCTGGAGAGGGAGAAAGG + Intergenic
1037896269 8:22658542-22658564 CTGCCTCTGCAGAGGGAGTGAGG - Intronic
1038649559 8:29390202-29390224 CTTCCTCTCCAAAGGGTGACAGG + Intergenic
1040995882 8:53401606-53401628 TTTCATGTGGAGAGGGTGACTGG - Intergenic
1041138181 8:54783535-54783557 TTTCCTTTGCAGATGGAGACTGG + Intergenic
1041185398 8:55294922-55294944 CTTAATGTGCAAAGGGACACTGG - Intronic
1041350729 8:56945800-56945822 CTTCTTCTTCACAGGGAGGCAGG + Intergenic
1042562434 8:70082684-70082706 CTTCATCTACCGAGGGAGACTGG + Intergenic
1042935650 8:74055335-74055357 CTTCAAATGCAGAGGGACAGAGG - Intergenic
1044391759 8:91660669-91660691 CCTCATCTGCAGACTGAGCCAGG + Intergenic
1045000267 8:97871998-97872020 CTTCATCTGTAAATGAAGACTGG + Intronic
1045008342 8:97935849-97935871 CTACATCTGCAGATTGGGACAGG + Intronic
1045799566 8:106086917-106086939 CTTACTCTGCTGAGGAAGACAGG + Intergenic
1047366771 8:124218383-124218405 CTGCTTATGTAGAGGGAGACAGG - Intergenic
1048283429 8:133122620-133122642 CTACATCTGCAGAGAGTAACAGG + Intronic
1048907491 8:139102481-139102503 TTTCATCCCCAGAGTGAGACAGG + Intergenic
1049784805 8:144445209-144445231 CTTCAGCTGCAGAAGTAGCCCGG + Intergenic
1050279429 9:4034850-4034872 CTTCTTCTTCAGAGGGTGAGTGG + Intronic
1052664223 9:31473696-31473718 CCTCATCATCAGAGGGAAACAGG + Intergenic
1056682955 9:88735811-88735833 CTTCACCTTCAGAGGAATACAGG - Intergenic
1057181294 9:93032093-93032115 ATTCATCTGCCGATGGACACGGG + Intronic
1057188606 9:93073126-93073148 CTGCCTGTGCCGAGGGAGACAGG + Intronic
1057301766 9:93890324-93890346 ATTCATCTGTTGAGGGACACTGG - Intergenic
1057620020 9:96626534-96626556 CATCATCTGCAAAGGGTGAAGGG - Intergenic
1058119160 9:101119441-101119463 CATCACCTCCAGAGGGACACTGG - Intronic
1059358520 9:113720072-113720094 CTCCAGCTGCAGATGGAGGCGGG - Intergenic
1060848653 9:126857431-126857453 CCTCCTCTGCAGAGGCAGCCAGG + Intergenic
1062430154 9:136523332-136523354 CTTCATCTGCCAAAGGCGACCGG - Intronic
1062434875 9:136542509-136542531 CGGCTTCTGCAGAGGGAGAAGGG + Intronic
1062725063 9:138068237-138068259 CTGCATCTGCAGAGGAGGAAGGG + Intronic
1203608586 Un_KI270748v1:76173-76195 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1186256924 X:7731994-7732016 CTACATCTGCAGAATGAAACTGG - Intergenic
1187433528 X:19246557-19246579 GTTTATCTGTAGAAGGAGACAGG - Intergenic
1187598299 X:20799217-20799239 CTTCATCAGCAGTGTGAGAATGG + Intergenic
1188164129 X:26840446-26840468 GATCATCTGCAGAGAGAGATAGG + Intergenic
1190259574 X:48789644-48789666 CTTCCTCTGAAGAGGGTGGCAGG - Intronic
1190282447 X:48939988-48940010 ACACAGCTGCAGAGGGAGACAGG + Intronic
1195016363 X:100785588-100785610 CTGCATATGCAGAAGCAGACAGG - Intergenic
1195072349 X:101292644-101292666 CATCCTCTGGAGAGGGACACAGG + Intronic
1196010345 X:110880295-110880317 ATCCATCTGCAGATGGTGACAGG + Intergenic
1196167540 X:112551993-112552015 CTTCTTCTGGAAAGGGAGAGGGG - Intergenic
1196687593 X:118525300-118525322 GGTCATCTGCTGAGGGACACTGG - Intronic
1196794419 X:119490768-119490790 CTGCACCTGCAGAGGGAGATTGG - Intergenic
1198958739 X:142161331-142161353 ATCCATGTGGAGAGGGAGACAGG - Intergenic
1199320587 X:146433535-146433557 CTTCACCAGCAGAGGCAGAGTGG - Intergenic
1199371371 X:147053410-147053432 TGTCATCTGCAGACGGAGACAGG - Intergenic
1200311092 X:155078114-155078136 CTTCAGCTGCAGACTGAGGCAGG - Intronic
1201518395 Y:14843790-14843812 CTTGATCTTCAGAGGCACACAGG + Intronic