ID: 948633842

View in Genome Browser
Species Human (GRCh38)
Location 2:239321220-239321242
Sequence CTTTGGAAGGTGAAGGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148242
Summary {0: 5, 1: 125, 2: 2466, 3: 32371, 4: 113275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948633832_948633842 11 Left 948633832 2:239321186-239321208 CCAGGCGCAGTGGCTCACGCCTG 0: 9533
1: 58782
2: 109662
3: 131093
4: 137784
Right 948633842 2:239321220-239321242 CTTTGGAAGGTGAAGGTGGGCGG 0: 5
1: 125
2: 2466
3: 32371
4: 113275
948633835_948633842 -8 Left 948633835 2:239321205-239321227 CCTGTAATCCCGGCACTTTGGAA 0: 98
1: 12506
2: 305838
3: 263550
4: 146364
Right 948633842 2:239321220-239321242 CTTTGGAAGGTGAAGGTGGGCGG 0: 5
1: 125
2: 2466
3: 32371
4: 113275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948633842 Original CRISPR CTTTGGAAGGTGAAGGTGGG CGG Intronic
Too many off-targets to display for this crispr