ID: 948637087

View in Genome Browser
Species Human (GRCh38)
Location 2:239345468-239345490
Sequence TGGGAGGATCGCTGAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102195
Summary {0: 9, 1: 362, 2: 5645, 3: 30290, 4: 65889}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948637082_948637087 -1 Left 948637082 2:239345446-239345468 CCAGCTACTCGGGAGCCTGAGGT 0: 59
1: 7822
2: 141056
3: 311205
4: 213311
Right 948637087 2:239345468-239345490 TGGGAGGATCGCTGAAGCCCAGG 0: 9
1: 362
2: 5645
3: 30290
4: 65889
948637077_948637087 11 Left 948637077 2:239345434-239345456 CCAGAGGTGGTCCCAGCTACTCG 0: 1
1: 1
2: 12
3: 158
4: 996
Right 948637087 2:239345468-239345490 TGGGAGGATCGCTGAAGCCCAGG 0: 9
1: 362
2: 5645
3: 30290
4: 65889
948637080_948637087 0 Left 948637080 2:239345445-239345467 CCCAGCTACTCGGGAGCCTGAGG 0: 802
1: 106664
2: 296492
3: 224693
4: 120027
Right 948637087 2:239345468-239345490 TGGGAGGATCGCTGAAGCCCAGG 0: 9
1: 362
2: 5645
3: 30290
4: 65889

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948637087 Original CRISPR TGGGAGGATCGCTGAAGCCC AGG Intronic
Too many off-targets to display for this crispr