ID: 948638847

View in Genome Browser
Species Human (GRCh38)
Location 2:239360442-239360464
Sequence GCACCCTGCCTTCCTGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 3, 3: 61, 4: 410}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948638842_948638847 7 Left 948638842 2:239360412-239360434 CCACAGACAGGACCTTCAGGGTC 0: 1
1: 0
2: 2
3: 21
4: 292
Right 948638847 2:239360442-239360464 GCACCCTGCCTTCCTGCAGCAGG 0: 1
1: 0
2: 3
3: 61
4: 410
948638839_948638847 14 Left 948638839 2:239360405-239360427 CCAACAGCCACAGACAGGACCTT 0: 1
1: 1
2: 0
3: 17
4: 252
Right 948638847 2:239360442-239360464 GCACCCTGCCTTCCTGCAGCAGG 0: 1
1: 0
2: 3
3: 61
4: 410
948638844_948638847 -5 Left 948638844 2:239360424-239360446 CCTTCAGGGTCTGCCCAGGCACC 0: 1
1: 0
2: 4
3: 30
4: 282
Right 948638847 2:239360442-239360464 GCACCCTGCCTTCCTGCAGCAGG 0: 1
1: 0
2: 3
3: 61
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948638847 Original CRISPR GCACCCTGCCTTCCTGCAGC AGG Intronic
900178191 1:1299830-1299852 GCACGCCGCCATCCAGCAGCGGG - Exonic
900270220 1:1783170-1783192 GCACCCTGCCTCCCGGCTGCTGG + Intergenic
900322174 1:2090318-2090340 GCACCCAGCCCTCCCGCAGAAGG + Intronic
900396583 1:2455520-2455542 GCAGCCCGCCTTCCTGCAGGTGG + Intronic
900398568 1:2463400-2463422 GCAGCCTGCCTACCAGCACCAGG - Intronic
900412962 1:2521377-2521399 GCACCCTGCCCTAGTGGAGCTGG + Intronic
900431251 1:2604179-2604201 GCACCATGTCCTCCTGCACCAGG + Exonic
901165983 1:7221863-7221885 GACCCCTGCCTTCCTTCAGAGGG + Intronic
901600763 1:10421801-10421823 GCACCCAGCCTTGCTGCCACTGG - Intergenic
903360217 1:22772262-22772284 GTCCCCTGCCTGCCTGCCGCTGG - Intronic
903788145 1:25875051-25875073 GGCCGCTGCCTTCCTGGAGCAGG - Intergenic
903965189 1:27084076-27084098 GTTCCCAGCCTCCCTGCAGCTGG + Intergenic
904160383 1:28518452-28518474 GCACCGCGCCTTCCTGCCTCCGG - Intronic
904833771 1:33321948-33321970 GCACCCTGCAAACTTGCAGCAGG + Intergenic
904886168 1:33740232-33740254 GTTCCCTGCCTTCCTCCAGCAGG + Intronic
904975429 1:34452473-34452495 TTACCCTGCCTGCCTGCAGAGGG - Intergenic
905825258 1:41021820-41021842 GCACCCAGCCTGCCTGTGGCTGG - Exonic
907630551 1:56077068-56077090 TCAGCATCCCTTCCTGCAGCTGG + Intergenic
907911963 1:58834807-58834829 CCCCCTTGCCTGCCTGCAGCAGG - Intergenic
908802789 1:67897542-67897564 CCTGCCTGCCTGCCTGCAGCAGG - Intergenic
910101351 1:83582109-83582131 GCTCCATGCAATCCTGCAGCTGG + Intergenic
910631510 1:89360131-89360153 GCATTCTTCCTTGCTGCAGCAGG - Intergenic
910981143 1:92961231-92961253 GCCCCCTGCCGTCCGGCACCTGG - Intronic
911139954 1:94489268-94489290 GCATGCTGCCTTCCTGCAAACGG - Intronic
911766455 1:101681423-101681445 GCACCCTGCCTGACTGCCACTGG + Intergenic
912543520 1:110434502-110434524 GGAATCTGCCTTCCTTCAGCAGG + Intergenic
913526377 1:119697353-119697375 ACACCCTGCCCTGCTTCAGCTGG + Intronic
915456162 1:156042152-156042174 GCTCCCAGTCTTCCTGCAGCAGG - Exonic
915509710 1:156379888-156379910 TTACCCTGCCTTCCTGCATGAGG - Intronic
915513657 1:156400698-156400720 GCTCCCCGCCATCCTTCAGCCGG + Intergenic
917720865 1:177785277-177785299 GCCTCCTGCCTTTGTGCAGCAGG - Intergenic
917971141 1:180208622-180208644 GCACCATGCCTTCCACCAGCTGG + Intergenic
918217652 1:182406996-182407018 TCACCCTGTCTTCCTAAAGCTGG - Intergenic
918239007 1:182605425-182605447 GAACGTGGCCTTCCTGCAGCTGG - Intergenic
919753295 1:201051791-201051813 GCTCCCTTCCTTCCTAGAGCAGG + Intronic
920631572 1:207658469-207658491 AGACCCTGCACTCCTGCAGCTGG + Intronic
920642058 1:207762599-207762621 AGACCCTGCCCTCCTGCAGCCGG + Intronic
920834967 1:209502314-209502336 ACACCCTGCTTCCCTGGAGCTGG - Intergenic
920852508 1:209637955-209637977 GAACCCTGTCTCTCTGCAGCTGG - Exonic
922785237 1:228279326-228279348 GCACCGTGCCCTCCTGCTCCAGG - Exonic
922921495 1:229308847-229308869 AAACCCTTCCTTCCTGCAGTAGG + Intergenic
923261445 1:232272073-232272095 GCAGCCTGTCGTCCTGCTGCTGG + Intergenic
924230521 1:241958468-241958490 GGACCCTGGCATACTGCAGCTGG - Intergenic
924733265 1:246731516-246731538 GCACCCTCCCTTCATTCTGCTGG - Intronic
924797266 1:247301273-247301295 GCATGTTGCCTTCCTGTAGCTGG - Exonic
1063223229 10:3990574-3990596 GCACCTGGCCTTCCTCCTGCAGG - Intergenic
1063686419 10:8241075-8241097 GCACCCTGGAGTCCTGCAGATGG - Intergenic
1064128056 10:12681448-12681470 GCAGCCTCCGCTCCTGCAGCAGG + Intronic
1064432817 10:15285831-15285853 GTACCCAGCCAGCCTGCAGCCGG - Intronic
1065201348 10:23316214-23316236 GCTGCCTGCCCTGCTGCAGCTGG - Intronic
1066043669 10:31578377-31578399 GCTCCCTGCCAGCCTCCAGCAGG + Intergenic
1066171771 10:32856464-32856486 GCACCCTGCCTCCCTGGATTGGG + Intronic
1067066230 10:43105663-43105685 GGCCTCGGCCTTCCTGCAGCCGG + Intronic
1069602209 10:69715237-69715259 GCACGCTGTCTTCCAGGAGCTGG + Intergenic
1069725009 10:70571830-70571852 ACAGCCTGCCTTCCAGGAGCTGG + Intergenic
1069854312 10:71431299-71431321 GTGCCCTGCCTTCCTGCCCCAGG + Intronic
1069999760 10:72367615-72367637 GCATGCTGCCTTCCTAGAGCAGG + Exonic
1070139999 10:73731992-73732014 TCACCTTGCCCTTCTGCAGCCGG - Intergenic
1070550349 10:77486176-77486198 GCACCCTGCCCTCCTCCTGAAGG - Intronic
1070559227 10:77553362-77553384 GCCCCTTTCCTTGCTGCAGCAGG - Intronic
1070714581 10:78710037-78710059 CCACCCTGACTCCCTGCAACAGG - Intergenic
1070761194 10:79025362-79025384 GCACCAGCCCTTCCTGCAGCAGG - Intergenic
1071183848 10:83018426-83018448 GGTCCCTGACTTCCTGCAACAGG - Intergenic
1072478196 10:95784037-95784059 ATATCCTGCCTTCCTGCAGGAGG + Intronic
1074126921 10:110535996-110536018 TCTCTCTGCCTTCCTGCAGTCGG - Intergenic
1074430638 10:113391205-113391227 TCACCCTCTTTTCCTGCAGCAGG + Intergenic
1075122169 10:119672304-119672326 CCAGCCTGCCTTCCTCCGGCAGG + Exonic
1075440850 10:122478319-122478341 GTACCTTGCCTCCCTGCAGGTGG + Intronic
1075838547 10:125477264-125477286 GCACCCTGCCTGGCTCCAGCAGG + Intergenic
1076066898 10:127455951-127455973 GCACACTGCTTCACTGCAGCTGG + Intergenic
1076325522 10:129617879-129617901 GCACCCAGCCTTCCGGCACTGGG + Intronic
1076484687 10:130808441-130808463 ACACGCAGCCCTCCTGCAGCCGG - Intergenic
1076841360 10:133047478-133047500 TGATGCTGCCTTCCTGCAGCTGG + Intergenic
1076924749 10:133476757-133476779 GCTCCCTGCCGGCCTGCAGCGGG - Intergenic
1076992194 11:281267-281289 GCACCCCGCCGTCCTCCAGCAGG - Exonic
1077181986 11:1220843-1220865 CCACCGTGCCGTGCTGCAGCGGG + Intergenic
1077265670 11:1648356-1648378 CCACCCGGCCTTCCCGAAGCAGG + Intergenic
1077326715 11:1967129-1967151 GCACCCTGCCTGGCTTCAGGAGG + Intronic
1077369119 11:2173344-2173366 GCACTCAGCCTGCCTGCAGAGGG - Intergenic
1077528588 11:3083923-3083945 GCCTCCTGCCCTACTGCAGCAGG - Intergenic
1078509774 11:11976685-11976707 GGACCCTGCCCTCCTGCAGCAGG - Intronic
1078543366 11:12228969-12228991 GCACCCTGCCATCCTGGAGAGGG - Intronic
1079356616 11:19735248-19735270 GCTCACTGCCATCCTGCAACTGG - Intronic
1079875201 11:25847563-25847585 GCAACCTGCCTTTCGGCAGCAGG - Intergenic
1080485588 11:32704038-32704060 GCAACCTCCCTTGCTGCAGCTGG - Intronic
1080852175 11:36079125-36079147 TCACGCTTCCTTACTGCAGCTGG + Intronic
1081666756 11:44921139-44921161 TCACCCTGCCTTCCTGCATTGGG + Intronic
1081692533 11:45088111-45088133 CCACCCTGCCATGCTGCAGCCGG - Intergenic
1082243544 11:49893735-49893757 GCGCCCCGCCACCCTGCAGCTGG + Intergenic
1083603246 11:63961770-63961792 GCACCCTTCCCTCCCGCTGCTGG + Intergenic
1083654928 11:64224967-64224989 GCACCCTGCCTGCCCACAGATGG - Exonic
1083770510 11:64864382-64864404 GCACCCGGACTCCCTGCAGCTGG + Intronic
1083923543 11:65792919-65792941 GCACCCTGCCATCCCACAGCCGG - Intronic
1084005024 11:66317960-66317982 GCACCCTGCCTTCCTGACGCAGG - Intergenic
1084273965 11:68042635-68042657 GCGCCCAGCCTTCCTGCAGGAGG + Exonic
1084690097 11:70720113-70720135 GGACCCTGCCCTCATGGAGCTGG - Intronic
1085237955 11:75029960-75029982 GCCCCCTGCCTTCCTGCACAGGG + Intergenic
1085504538 11:77049591-77049613 GCTCCATGCCTTCCTCCGGCAGG - Intergenic
1085533123 11:77203276-77203298 GCACACTGCCTTCCTCCTGAGGG + Intronic
1085539461 11:77253512-77253534 GTACCCTGCTTCCCTGGAGCTGG - Intronic
1088157617 11:106827876-106827898 GCGCGCTGCCTTCATGCTGCCGG + Intronic
1088651251 11:111959405-111959427 GCTCCCTGCGATGCTGCAGCTGG - Intronic
1089159294 11:116425114-116425136 GCCACCTGCCTTCCATCAGCAGG + Intergenic
1090426244 11:126608709-126608731 GCCCCCTGCCTGCCTCCAGGAGG - Intronic
1090765851 11:129875598-129875620 GCACTCTGCCCTCCAGCAGCTGG + Intronic
1091181303 11:133606868-133606890 CCACCCTATCTTCCTCCAGCAGG + Intergenic
1202809696 11_KI270721v1_random:22309-22331 GCACCCTGCCTGGCTTCAGGAGG + Intergenic
1091588087 12:1827453-1827475 GCACTCTGTCTTCCGCCAGCCGG - Exonic
1091884109 12:4003441-4003463 GCACCCTGCCTTCCAGCCCAAGG - Intergenic
1092002772 12:5045181-5045203 GAACCCTGCCTTGCTGGGGCAGG - Exonic
1092089066 12:5789249-5789271 GCAGCTTGCCTTCCTGCCCCAGG + Intronic
1092513523 12:9184147-9184169 GCACCCTGCCTTGCCACTGCTGG + Intronic
1092530155 12:9337329-9337351 GGTCCCTGACTTCCTGCAACAGG + Intergenic
1092766946 12:11861512-11861534 TCACCCTTCCTGCCTGCACCAGG + Intronic
1096809481 12:54160442-54160464 GCACCATGCCTGCCTATAGCAGG - Intergenic
1096821489 12:54239101-54239123 TCTTCCTGCCTACCTGCAGCTGG - Exonic
1098326846 12:69312228-69312250 GTACCCTGCTTTCCTGGAGCTGG + Intergenic
1100618381 12:96249228-96249250 GGACACTGCCTTCTCGCAGCGGG - Intronic
1101915746 12:108894334-108894356 GCCCCCGGCCTGGCTGCAGCAGG - Exonic
1102073065 12:110037643-110037665 GCACCTTGCGTGCATGCAGCAGG + Exonic
1102555630 12:113724831-113724853 GCCCCCTGCCTCCCAGCAGGTGG + Intergenic
1102609523 12:114099268-114099290 GCACCCTGCCTAGATGCTGCCGG - Intergenic
1103521299 12:121538074-121538096 GCTCGCTGCCTTCCTTCCGCGGG + Intronic
1103850412 12:123929361-123929383 GCACCCTGCCTTCAAGCCGCTGG + Exonic
1103940159 12:124496979-124497001 TCGCCCTGCCTTCCTGCCGGTGG - Intronic
1104605682 12:130185774-130185796 GCTCCATGCCTCCCTGCAGAAGG + Intergenic
1104899606 12:132181845-132181867 CCACGCTGTCTTCCTGCCGCTGG + Intergenic
1105007968 12:132734801-132734823 GCCTCCTTCCTGCCTGCAGCCGG - Intronic
1106127571 13:26912882-26912904 GCACCCTGGCTTTCTGGAGTTGG + Intergenic
1107145775 13:37059435-37059457 GGACCCCGTCTTCCTCCAGCGGG + Intronic
1108275480 13:48805236-48805258 ATACCCTGCCTGCCTGCTGCAGG + Intergenic
1108542314 13:51455729-51455751 GCTGCCCGCCCTCCTGCAGCTGG - Intergenic
1111822114 13:93227452-93227474 GCACCATGCCTTCTTGGATCGGG + Exonic
1112828046 13:103414666-103414688 GAACTCTGCCTTCCTGCTGAGGG + Intergenic
1112966713 13:105205726-105205748 GCAGCCTGACTTCCTGACGCAGG - Intergenic
1113521464 13:110944852-110944874 TCCTCCTGCCTGCCTGCAGCTGG + Intergenic
1113676261 13:112209783-112209805 GCACCCTGCCTGCCTTCCACAGG - Intergenic
1113682803 13:112255936-112255958 GGGCCCTTCCTTCCTGGAGCAGG - Intergenic
1113800952 13:113085973-113085995 CCTGCCTGCCCTCCTGCAGCTGG - Intronic
1113869575 13:113550627-113550649 GCACCCAGCCTTCCTCCCTCTGG - Intronic
1115381712 14:32746869-32746891 ACTCCCTGACTTCCTCCAGCCGG - Intronic
1118285252 14:64465329-64465351 GCAGCCTGCCTGCCTGCCGCGGG - Intronic
1118813192 14:69290399-69290421 GAACCCAGGCTGCCTGCAGCTGG + Intronic
1120588403 14:86345609-86345631 GCACTCTGCCTTTCTGCACTTGG - Intergenic
1120592412 14:86391283-86391305 GCTGCCTGCCTAGCTGCAGCTGG + Intergenic
1121234544 14:92382839-92382861 GCACCCTGCCCTCCAGTGGCAGG + Intronic
1122024801 14:98867923-98867945 GCACCCAGAATGCCTGCAGCAGG + Intergenic
1122131840 14:99608641-99608663 GGACCCTGACTTCTTGCTGCTGG - Intergenic
1122226844 14:100285411-100285433 GCACAGTGCCCTCCTGCGGCCGG - Intergenic
1122324795 14:100875660-100875682 ACCCCCTCCCTTCCTGCAGGAGG + Intergenic
1122496938 14:102163838-102163860 GCACTCTCCCTTCCAGAAGCAGG + Intronic
1122813412 14:104300224-104300246 CCACCCTGCCCTCCTCCACCGGG - Intergenic
1122920882 14:104879652-104879674 GCACCCTTCCTTCCTGCCTCTGG - Intronic
1123937602 15:25201578-25201600 GCACTCTGCTTTCCTGGAGGCGG + Intergenic
1127041832 15:54985315-54985337 GCACCCTGCCTGCCTCCTTCTGG + Intergenic
1127480386 15:59372215-59372237 ACACCCTGGCTTCCGACAGCTGG + Intronic
1128987137 15:72230237-72230259 CCGCCCTGCCTCCCGGCAGCGGG + Intronic
1129690306 15:77709602-77709624 AAACCCAGCCTTCCTGCACCCGG + Intronic
1129734412 15:77951760-77951782 GCCCCCTGCCTTCTGGCTGCGGG - Intergenic
1129841177 15:78744231-78744253 GCCCCCTGCCTTCTGGCTGCGGG + Intergenic
1130537671 15:84798718-84798740 GCTCCCTGCCTTCTGGCCGCTGG + Exonic
1130551929 15:84894941-84894963 GCTCTCTGCCTTCCTGCTGGTGG + Exonic
1130648430 15:85748410-85748432 GTGCCTTGCCTTCCTTCAGCAGG + Intronic
1131423547 15:92326887-92326909 GGCCCCTGCCTTCCTGGAACAGG + Intergenic
1132199887 15:99944087-99944109 GCACCCTGCATTCCAGCAAATGG - Intergenic
1132476778 16:143208-143230 CCACCCGGCCCTCCTGCAGATGG - Intergenic
1132710719 16:1265916-1265938 GGACCCTGCCTCCCGGCAGCTGG - Intergenic
1133619290 16:7510983-7511005 ACACCCTCCCTTTCTGCATCTGG - Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1135422865 16:22316579-22316601 ACACCCTGCCCTCCTCCAACAGG + Exonic
1136102449 16:28006017-28006039 TCTCCCTCTCTTCCTGCAGCTGG - Intronic
1136143380 16:28301333-28301355 TGACGCTGCCTTCCTGCAGCTGG - Intronic
1136186599 16:28592140-28592162 GCTCCCTGCCTTCCTCCCCCAGG - Exonic
1136189220 16:28605933-28605955 GCTCCCTGCCTTCCTCCCCCAGG - Exonic
1136317812 16:29464441-29464463 GCTCCCTGCCTTCCTCCCCCAGG + Exonic
1136432387 16:30203786-30203808 GCTCCCTGCCTTCCTCCCCCAGG + Exonic
1136574163 16:31113377-31113399 GCACCCTGCCTTGCAGCTGGCGG - Intergenic
1137237270 16:46626183-46626205 CCACCCTGCCAGCCAGCAGCTGG - Intergenic
1137576262 16:49602312-49602334 ACACCCTGCCTTCCAGGGGCTGG - Intronic
1137686449 16:50390262-50390284 TCAGCTTGCCTTCCTGCAGAAGG - Intergenic
1137711833 16:50572015-50572037 GCACGCTCTATTCCTGCAGCTGG + Intronic
1138883854 16:61050689-61050711 GCACCCTGCTGTACTGCCGCCGG - Intergenic
1139129966 16:64131653-64131675 GCTGCCTGCCTGCCTGCAGATGG - Intergenic
1139581691 16:67877638-67877660 TCACCCGGTCTTCATGCAGCAGG - Exonic
1139776686 16:69320830-69320852 GCACCCGGGCTGCCAGCAGCAGG - Intronic
1139849037 16:69939761-69939783 CCACCATGCCTGCCTGCAGCAGG - Intronic
1141393352 16:83682828-83682850 GGACCCTGAGATCCTGCAGCAGG + Intronic
1141858589 16:86701365-86701387 GCACCCTGCGGGCATGCAGCAGG + Intergenic
1141876485 16:86828447-86828469 TGGCCCTGCCTCCCTGCAGCTGG - Intergenic
1142207620 16:88791456-88791478 GCCACCTGCCTGCCTGAAGCTGG + Intergenic
1142888794 17:2929720-2929742 GCCCACTGCCTTCGTGGAGCGGG - Intronic
1143285519 17:5786157-5786179 GCTCCCTCCCTTCCTGTAGGGGG - Intronic
1143490806 17:7284282-7284304 GCTACCTGCCCTCCTGCAGCTGG + Exonic
1143514639 17:7413695-7413717 GCACCCTGGCTTCATTAAGCAGG + Intronic
1144698509 17:17321793-17321815 GCGGCCTGCCTTCATCCAGCTGG - Intronic
1144704034 17:17355689-17355711 CCACACTGCCTCCCTGCTGCAGG - Intergenic
1148841143 17:50498176-50498198 GCTCCCTGCCTTCTCTCAGCAGG + Intergenic
1149550361 17:57535092-57535114 GCACCCTTCCTCCCTCCCGCTGG - Intronic
1151215766 17:72575434-72575456 GGCCCTTGCCTTCCAGCAGCTGG - Intergenic
1151557207 17:74852584-74852606 GGGCTCCGCCTTCCTGCAGCTGG - Exonic
1151815531 17:76469724-76469746 GCACCGCGCCTTCCGGCAGCAGG + Exonic
1151880836 17:76893566-76893588 GCACCCAGTCTTTCTCCAGCTGG - Intronic
1152335984 17:79700498-79700520 GCACTCTGCCTTGCTTCAGGAGG + Intergenic
1152415153 17:80155119-80155141 GGTCCCTGGCTTCCTGCAACAGG - Intergenic
1152696765 17:81801498-81801520 TCACCCTGCCTGCCTTCAGCAGG - Intergenic
1153814792 18:8783082-8783104 GAACCCTGTCTGCCTGCACCAGG + Intronic
1154084805 18:11293362-11293384 TCACCCAGCCTTGCTGGAGCTGG + Intergenic
1156379664 18:36546578-36546600 ACACCCTCCCTTCCTGGTGCTGG - Intronic
1156485514 18:37463285-37463307 GCACCAGGCCTGGCTGCAGCAGG + Intronic
1156783708 18:40882698-40882720 GCACCTTGCCTTGCTGCTGGAGG - Intergenic
1157467539 18:47960298-47960320 GGTCCCTGACTTCCTGCAACAGG - Intergenic
1157594316 18:48854588-48854610 CCACCCTTCCCTCCTACAGCAGG + Intronic
1158404807 18:57151619-57151641 GCACCCTGGTTTCCTGCATGGGG - Intergenic
1158407345 18:57171859-57171881 GGTCCCTGACTTCCTGCAACTGG - Intergenic
1159334444 18:67044517-67044539 GCTGCCTGCCCTGCTGCAGCTGG + Intergenic
1159946733 18:74449544-74449566 CCCCCCTGGCTTCCTGCTGCGGG + Intronic
1160371827 18:78378526-78378548 AGCTCCTGCCTTCCTGCAGCAGG - Intergenic
1160810450 19:1010841-1010863 GCTGCCTGCCATCCTGCAGCAGG - Exonic
1161018726 19:1997559-1997581 GCTCCCTGCCAGCCTCCAGCAGG + Intronic
1161226718 19:3150344-3150366 GCTGGCTGGCTTCCTGCAGCAGG + Intronic
1161315929 19:3617667-3617689 CCTCCCAGGCTTCCTGCAGCCGG + Intronic
1161706777 19:5825805-5825827 TGTCCCTGCCTCCCTGCAGCGGG - Intronic
1161723029 19:5914180-5914202 GCACAGTGCATTCATGCAGCTGG + Exonic
1163523808 19:17808119-17808141 GCAGCCGGTCTTCCTGCTGCTGG + Exonic
1163602427 19:18257158-18257180 GGACCCTGGCTCCCTGCAGTGGG - Exonic
1163638808 19:18450294-18450316 GCACCCTATGTTCCTGCACCTGG - Intronic
1164743549 19:30594628-30594650 GCCCCCTGCCTCTCTCCAGCAGG - Intronic
1164829209 19:31307742-31307764 GCAGCCTGCCTTCCTTAGGCGGG + Intronic
1164833248 19:31339377-31339399 GCACCCAGCCATCCAGAAGCAGG + Intronic
1165792585 19:38500802-38500824 CCACCCTCCCTGCCTGCAGATGG + Exonic
1165826718 19:38709827-38709849 TCTCCCTCCCTACCTGCAGCAGG + Intronic
1166913310 19:46176726-46176748 GGTCCCTGCCACCCTGCAGCAGG + Intergenic
1167045172 19:47045450-47045472 GCACGCGGGCTTCCTGCCGCCGG + Exonic
1167211506 19:48136704-48136726 AAACCCTGGCTTCCTGCTGCAGG + Intronic
1167288217 19:48610715-48610737 GCTGCCTGCCTTCCTGGAACTGG - Exonic
1168272466 19:55257830-55257852 GCTCCCTGCCTGCCCTCAGCAGG + Intronic
1168316809 19:55488206-55488228 GTCCTGTGCCTTCCTGCAGCCGG + Intergenic
925412242 2:3646551-3646573 GCACCTTGTCTTCATGGAGCAGG + Intergenic
925702213 2:6650171-6650193 CCATGCTGCCTTCATGCAGCAGG + Intergenic
926066399 2:9843663-9843685 CCGCCCCGCCTTCCTCCAGCCGG - Intronic
926134924 2:10329789-10329811 GAACTTTGCATTCCTGCAGCTGG - Intronic
927554357 2:24021913-24021935 GCACCCACCCTACCTGAAGCTGG + Exonic
927575750 2:24200693-24200715 GCACCTGGCCTCCCTGCAGAAGG + Intronic
928127248 2:28625312-28625334 CCACCTTGCCCTCCCGCAGCCGG - Intronic
928171949 2:29009863-29009885 GGCCCCTGCCTTCCTGCACGTGG - Intronic
928213304 2:29339912-29339934 GCACTCTGCCTTCCTGCGGGTGG - Intronic
928239768 2:29576395-29576417 GCACACTGCCTTCCAACTGCAGG + Intronic
928319592 2:30272527-30272549 GCAGCCTGCATCACTGCAGCTGG + Intronic
930022459 2:47009558-47009580 ACACCCCGCCTCCCTCCAGCTGG - Intronic
934640106 2:96022853-96022875 GCAGCCTGCCTTCCTAGAGTTGG + Intronic
935105984 2:100044160-100044182 GAACCCTGCCATCCTGAAGTAGG - Intronic
936694493 2:114929986-114930008 GGTCCCTGACTTCCTGCAGCAGG + Intronic
937069937 2:119055566-119055588 GATCCCTGACTTCCTGCAACAGG + Intergenic
937091237 2:119207732-119207754 GGACTCTGCCTACCTGGAGCAGG - Intergenic
937956564 2:127425000-127425022 GCACCACTCCTTCCTGAAGCGGG + Intronic
938069255 2:128299909-128299931 CCACCCTGCCTTGCTGGCGCTGG - Intronic
938119305 2:128622667-128622689 ACACCCTGCCTTCCTGTCGGAGG + Intergenic
939178605 2:138780190-138780212 GGTCCCTGGCTTGCTGCAGCTGG - Exonic
940983122 2:160024769-160024791 GCACCTTGCCTTCCTGGAACTGG + Intronic
942516976 2:176764452-176764474 GCACGCAGCTTTTCTGCAGCAGG - Intergenic
943475831 2:188354010-188354032 GTACCCTGCTTCCCTGGAGCTGG + Intronic
944557703 2:200904465-200904487 GGCCCCTGCCTGCCTGCTGCTGG + Intergenic
945026405 2:205623939-205623961 CCACCCTGCTTTCTTGTAGCAGG + Intergenic
945470618 2:210224795-210224817 GCAGCCCGCGCTCCTGCAGCCGG + Intronic
945488635 2:210428083-210428105 GGTCCCTGACTTCCTGCAACAGG + Intergenic
945611600 2:212011290-212011312 GGTCCCTGACTTCCTGCAGCAGG + Intronic
947740098 2:232481043-232481065 GCCCCCGTCCCTCCTGCAGCAGG + Intronic
948434561 2:237944279-237944301 CGTCCCTTCCTTCCTGCAGCTGG - Intergenic
948580639 2:238985565-238985587 GGACCCTGCCTCCCAGCAGGAGG - Intergenic
948638847 2:239360442-239360464 GCACCCTGCCTTCCTGCAGCAGG + Intronic
948773860 2:240269899-240269921 GCACCCTGACTGCTTGCTGCTGG - Intergenic
948826556 2:240575885-240575907 TCACCCGCCCTTCCTGCACCAGG - Intronic
948860099 2:240748656-240748678 ACACCCCACCTTCCAGCAGCAGG + Intronic
1168808137 20:684862-684884 GCCCCCTGCCTCCATGCACCTGG - Intergenic
1168861714 20:1050431-1050453 GCACAGTGCCTGCTTGCAGCTGG + Intergenic
1171458018 20:25282815-25282837 GCACCTTCCCTGCCTGAAGCAGG - Intronic
1172273530 20:33667686-33667708 GAACCCTGACCTCTTGCAGCAGG + Exonic
1172999608 20:39096084-39096106 CCTCCCTGCCTTCTTCCAGCAGG - Intergenic
1173791222 20:45828903-45828925 GCACCCTGCCTGCCTGGGGGAGG - Intronic
1174343006 20:49909664-49909686 ACACCCTGCTTTCCTGAGGCAGG + Intronic
1174427406 20:50441929-50441951 AAACCCTGACTTTCTGCAGCTGG - Intergenic
1174540907 20:51288573-51288595 CCTCCCTGGCTTCCTGTAGCTGG + Intergenic
1175514432 20:59559940-59559962 GTTCCCTCCCTTCCTCCAGCTGG + Intergenic
1175542049 20:59754150-59754172 GGGCCCTGCCATCCTGCAGTTGG + Intronic
1175577389 20:60070969-60070991 GCACCGTGCATTCATCCAGCAGG + Exonic
1175951420 20:62585570-62585592 GCACCAAACCCTCCTGCAGCCGG - Intergenic
1176021722 20:62965558-62965580 GCACCCAGCCCGCCTGCAGCAGG - Intronic
1176271876 20:64239613-64239635 GGACCCTGCCTTCCTGTAGGGGG - Intronic
1178293386 21:31387904-31387926 GCAGCCTGCGTGCTTGCAGCAGG - Intronic
1179066193 21:38026903-38026925 GCATCCTGCTTTTCTGCTGCTGG + Intronic
1179197416 21:39178448-39178470 GTACACGACCTTCCTGCAGCAGG - Exonic
1179438864 21:41379646-41379668 GCTCCCCGTCTTTCTGCAGCTGG - Intronic
1181574092 22:23783039-23783061 GCACCCTGGAGTCCTGGAGCTGG - Intronic
1181710132 22:24679408-24679430 GCACCTCGCCTTGCTGCAGTTGG + Intergenic
1183617305 22:38953598-38953620 GCTCCCTCCCTTCCTGATGCAGG - Intronic
1184130088 22:42512472-42512494 CCGCCCTTCCTTCCTCCAGCTGG - Exonic
1184667770 22:45997658-45997680 GGGCCCTGGCTTCCTCCAGCAGG - Intergenic
1184743649 22:46443528-46443550 GCACCCCGCCGCCCTGCAGGCGG + Intronic
1185217470 22:49609707-49609729 CCACACTGCGTTCCTGCATCTGG + Intronic
950328781 3:12139116-12139138 GCACTCAGCCATCCTGGAGCTGG - Intronic
950668590 3:14511928-14511950 TCTCCCTGCCCTCCTGGAGCTGG + Intronic
953179345 3:40581902-40581924 ACACCCACCCTCCCTGCAGCAGG - Intergenic
953607653 3:44421950-44421972 GCACCAAGCCTTCCTGGAACAGG + Intergenic
954637060 3:52076754-52076776 TCATGCTGCCTTCCTGAAGCTGG + Intronic
955622319 3:60877761-60877783 GTACCCTGCTTTCCTGAAGCTGG + Intronic
955678500 3:61475137-61475159 GCTGCGTGCCCTCCTGCAGCTGG - Intergenic
955784965 3:62527700-62527722 GAACCTTGCCCTGCTGCAGCTGG - Intronic
956110052 3:65861161-65861183 GCTCCTTGCCTCCCTGCAGCTGG - Intronic
956678200 3:71754370-71754392 CCACGCCGCCTTCCTGCTGCTGG + Exonic
958625336 3:96615521-96615543 GGTCCCTGACTTCCTGCAACAGG + Intergenic
959559342 3:107761626-107761648 GCAACCAGCCTTCCCGAAGCAGG - Intronic
961239618 3:125399153-125399175 GCACCCTGCCTCCCAGGAGGAGG + Intergenic
961335735 3:126178970-126178992 GGACTCTGCCTCCCTGCAGGGGG - Intronic
961410177 3:126714666-126714688 CCACCCTGCCTGCCTGCTGTAGG + Intronic
961450280 3:126999497-126999519 GCCCCCTGCCTCCCGGCGGCTGG + Intronic
961705836 3:128784485-128784507 GCGCCCTGCCTGCCTGCAGTGGG - Intronic
961750389 3:129090875-129090897 CCACCCTGCCAGCCAGCAGCTGG - Exonic
962120375 3:132554612-132554634 GTTCCCTGCCCTTCTGCAGCTGG + Intergenic
964451381 3:156816560-156816582 TCACCCCGCCTGCCTGGAGCCGG - Intergenic
964840148 3:160984669-160984691 GGTCCCTGACTTCCTGCAACAGG + Intronic
965099955 3:164283559-164283581 GCTCCCTGCCTTCCAGCCCCTGG - Intergenic
965925364 3:173972215-173972237 GAAACCTGCCTGCCTGCAGCGGG + Intronic
965928987 3:174018563-174018585 GGTCCCTGACTTCCTGCAACAGG + Intronic
966301812 3:178487358-178487380 GCTTATTGCCTTCCTGCAGCTGG + Intronic
966491308 3:180531420-180531442 CCACCCTTCCCTGCTGCAGCCGG - Intergenic
966560423 3:181313666-181313688 GCATCAGGCCTTTCTGCAGCGGG - Intergenic
966851953 3:184170154-184170176 GCACCCGGGCTTCCCGGAGCTGG + Exonic
967108254 3:186271087-186271109 GTACCCAGCCCTCCTGCAGAAGG - Intronic
967914923 3:194571625-194571647 CCACCCTGGCTTCCTCGAGCAGG + Intergenic
967921422 3:194617149-194617171 GCACCCTGAGTACCTGCTGCGGG - Exonic
968062149 3:195733704-195733726 GGTCCCTGCCCTGCTGCAGCGGG - Intronic
968451829 4:679531-679553 GCCCCCTGCCCTCCTGCCTCAGG - Intronic
968572419 4:1348900-1348922 CCTTCCTTCCTTCCTGCAGCAGG + Intronic
968755056 4:2411248-2411270 ACCCCCTGCCTCCCTCCAGCAGG + Intronic
968977593 4:3830107-3830129 GCAGCCTTTCTTCCTCCAGCTGG + Intergenic
969431065 4:7154607-7154629 GCACCTTGGCTTCCTCGAGCTGG + Intergenic
969759141 4:9169886-9169908 GCCCTCTTCCTTCCTGCAGGAGG - Intergenic
970730805 4:19101312-19101334 GCATTCTTTCTTCCTGCAGCAGG + Intergenic
972399112 4:38683984-38684006 GCACCATGCCTTCCTGTGCCTGG + Intronic
972628454 4:40822960-40822982 GCTCACTGCCTGCCTCCAGCTGG - Intronic
973870028 4:55157526-55157548 GCTCCCTTCCTTCCTAGAGCAGG + Intergenic
974079103 4:57194620-57194642 CCACCCGGCCTTCCTGGAACTGG - Intergenic
975408603 4:74021892-74021914 GCTCCCAGTCTTCCAGCAGCTGG - Intergenic
975516480 4:75253890-75253912 CCAACCTGCTTTCCTGCAGTTGG - Intergenic
978822164 4:112979247-112979269 GCTGCCTGCCTTGCTGCAGCCGG - Intronic
980130682 4:128812777-128812799 GCGCCCTGCCTTACTTCGGCAGG + Intronic
980133197 4:128835572-128835594 ATACTCTGCCTTCCTTCAGCCGG + Intronic
983885301 4:172974794-172974816 GCTGCCTGCCCTGCTGCAGCCGG - Intronic
984680356 4:182601111-182601133 GGACCCAGCTGTCCTGCAGCTGG - Exonic
985517834 5:356250-356272 GCTCTCTGCCCTCCTGCTGCGGG + Intronic
985552297 5:539879-539901 GCACCGGGGCTCCCTGCAGCGGG + Intergenic
985658469 5:1143977-1143999 GCACCCTGCCCTCCTACCCCTGG + Intergenic
985733657 5:1565240-1565262 GCATCCTGCCTCCCTGCACCTGG + Intergenic
986000522 5:3627498-3627520 GGACCCTGCCTTCCTGCGGCGGG + Intergenic
990310273 5:54531102-54531124 GCACCCTGGCTCCCTGAGGCAGG + Intronic
990516430 5:56534956-56534978 TCACCCTGCCTGCCTGAACCTGG + Intronic
991562597 5:67970277-67970299 ACAGCATGGCTTCCTGCAGCAGG - Intergenic
991631110 5:68657162-68657184 ACACTCTGCCTTCTTGCAGATGG + Intergenic
992740743 5:79770993-79771015 GAAGCCTGCCTTCCAGCAGCTGG - Intronic
993512429 5:88788075-88788097 TCACCTTCCATTCCTGCAGCAGG - Intronic
996965922 5:129306859-129306881 CCAGCCTGCCTGGCTGCAGCAGG + Intergenic
997593794 5:135092663-135092685 GCCTCCTGCCTCTCTGCAGCGGG + Intronic
998108144 5:139481536-139481558 CCACCTAGCCTCCCTGCAGCTGG - Exonic
998259788 5:140621242-140621264 GGTCCCTGACTTCCTGCAACAGG - Intergenic
999280551 5:150362523-150362545 GAAACCTGTCTTCCTGAAGCAGG - Intronic
999801983 5:155046832-155046854 GCTCCCTGCTCTCCTGCACCTGG + Intergenic
1001652222 5:173324087-173324109 GCACCCTGCCTGGCAGCATCTGG + Intronic
1002075475 5:176705815-176705837 GAACCCTTGCTTCCTGGAGCTGG + Intergenic
1002330045 5:178434856-178434878 GATGCCTGCCTTCCTGCAGCGGG - Intronic
1003221353 6:4163664-4163686 CCTCCCTGCTTTCCTGTAGCAGG - Intergenic
1003320228 6:5044492-5044514 GAGCCCTGCCCTCCTGAAGCTGG - Intergenic
1004368520 6:15032392-15032414 GCCCCCTCAATTCCTGCAGCAGG + Intergenic
1005032517 6:21524348-21524370 GCACACTGCCTTACAGCAACTGG - Intergenic
1005569093 6:27127263-27127285 GCACCCTGCCTCCGTCCCGCAGG - Intronic
1006022283 6:31124329-31124351 GCACCGTGTCCGCCTGCAGCAGG - Intronic
1006034723 6:31202463-31202485 GCTCCTTCCCTTCCTGCAGCCGG - Exonic
1006188379 6:32192782-32192804 GCCCCCTCCACTCCTGCAGCTGG - Exonic
1006423317 6:33948915-33948937 GCTCCCCGTCTTCCTGCACCAGG - Intergenic
1007181424 6:39931933-39931955 GCAACCTGCCAGCCTGCATCTGG - Intronic
1007685485 6:43665020-43665042 GCAGCCTTCTTACCTGCAGCTGG + Intronic
1007741172 6:44010481-44010503 GCACCTGGCCATCCTGCAGAGGG + Intergenic
1008234813 6:49031722-49031744 ACACATTGTCTTCCTGCAGCTGG + Intergenic
1008615312 6:53220538-53220560 GTGCCCAGCCTTTCTGCAGCTGG + Intergenic
1010077890 6:71822249-71822271 GCAGCCTGCCTTGCTACTGCTGG - Intergenic
1010493032 6:76496678-76496700 GGTCCCTGACTTCCTGCAACAGG + Intergenic
1011240106 6:85262756-85262778 GCACCCTGCCTTGATCGAGCTGG - Intergenic
1011966791 6:93168770-93168792 GCTCAGTGCCTTCCTGCAACAGG + Intergenic
1013056465 6:106587984-106588006 GCACCTCGCCATCCTGCAGAGGG + Intronic
1013584583 6:111566899-111566921 GCACCCTCCCTCCCTCCAGCTGG + Intronic
1013668631 6:112374428-112374450 CCACTCTGCATTCTTGCAGCAGG + Intergenic
1015840492 6:137471649-137471671 GCACCCTGCCTTCCAGCTGGGGG + Intergenic
1016991647 6:149933850-149933872 GCTTCATGCCTTCCTGCAGGAGG + Intergenic
1017132023 6:151115613-151115635 GCACCGTGCCCTCCCTCAGCCGG + Intergenic
1018851938 6:167646684-167646706 GGACCATGCCTTCCTCCTGCGGG + Intergenic
1018914840 6:168126873-168126895 GGAGCCAGCCTTGCTGCAGCCGG - Intergenic
1019275496 7:173463-173485 GCTGGCTGCCTGCCTGCAGCGGG + Intergenic
1019350225 7:551068-551090 GCCACCAGCATTCCTGCAGCTGG - Intronic
1019571833 7:1716456-1716478 GCTGCCTTCCTTCCTGCCGCTGG + Intronic
1019611201 7:1937532-1937554 GCACCATGCAGCCCTGCAGCAGG + Intronic
1019653288 7:2172418-2172440 GCACCGTGACTTCCTGCTGCTGG - Intronic
1020015705 7:4830289-4830311 ACACACTGCCTTCCACCAGCAGG + Intronic
1020144729 7:5633725-5633747 CCACCCTACCTGCATGCAGCAGG - Intronic
1021195879 7:17673851-17673873 GCCCCCAGCTTTCCCGCAGCTGG - Intergenic
1021959590 7:25858623-25858645 TCACCCTGCGCCCCTGCAGCGGG - Intergenic
1022102607 7:27177449-27177471 GCAGCCGGCCCGCCTGCAGCCGG - Intronic
1023156118 7:37254125-37254147 GCCTCCTGCCTTCCTTCTGCTGG - Intronic
1023265846 7:38404365-38404387 GCACTATGCCCTTCTGCAGCAGG - Intronic
1023603920 7:41909931-41909953 GGTCCCTGACTTCCTGCAACAGG + Intergenic
1023677551 7:42646320-42646342 CCCCACTTCCTTCCTGCAGCAGG + Intergenic
1024111970 7:46156321-46156343 GCTCCCAGACTTCCTGCAGAAGG - Intergenic
1024249000 7:47492265-47492287 AAACCCAGCCTTCCTGCTGCTGG - Intronic
1024578257 7:50782248-50782270 GCCCCCTGCCCGCCTGCCGCGGG - Intronic
1024597141 7:50947634-50947656 GTACCCTACTTTCCTGGAGCTGG + Intergenic
1024942306 7:54775574-54775596 GGTCCCTGACTTCCTGCAACAGG - Intergenic
1026901319 7:74038952-74038974 ATACCCTGTCTTCCTGGAGCAGG + Intronic
1027162274 7:75811568-75811590 GCCCCTTGCCTTTCTGGAGCTGG - Intergenic
1028061276 7:86320193-86320215 GCACCCAGCATTGCTGCAGAAGG - Intergenic
1028527301 7:91800664-91800686 GCTCCCTGCAAGCCTGCAGCTGG + Intronic
1029435956 7:100564164-100564186 CCAGCCTGCCTTCCTGCAGGCGG - Intronic
1029899437 7:104023240-104023262 GCAGCCTGCCCTGCTCCAGCAGG + Intergenic
1031301872 7:120069955-120069977 GTACCCTGCTTGCCTGGAGCTGG + Intergenic
1033145369 7:138866542-138866564 GAGCCCTGCCTTGCTGCAGCAGG - Intronic
1033964470 7:146958257-146958279 GCTCACTGCCTTCCTCCATCTGG - Intronic
1034640667 7:152599810-152599832 GCACACCGCCTACCTGCGGCTGG + Intergenic
1034875368 7:154720515-154720537 GCTCTCTGCCATCCTGGAGCAGG - Intronic
1035021910 7:155805258-155805280 GCCTCCTGCCTGCCTGCAGCCGG + Intronic
1035025891 7:155825479-155825501 GCACACTTCCTTCCTGTACCAGG - Intergenic
1035698020 8:1614989-1615011 GCACCCTCGCTACCTGCTGCAGG + Intronic
1036020739 8:4842591-4842613 GCACCCGGGTTCCCTGCAGCAGG - Intronic
1036650102 8:10636702-10636724 GACCGCTGCCCTCCTGCAGCTGG - Intronic
1036692370 8:10951953-10951975 GCCCCCTGCCCTCCTCTAGCTGG + Intronic
1036754068 8:11460978-11461000 GCTCCCAGCCTTCCTGCAGGAGG - Intronic
1036915346 8:12799128-12799150 GCTGCCTGCCCTGCTGCAGCTGG - Intergenic
1040977914 8:53214724-53214746 GCACCCTGCCATGCTACTGCTGG - Intergenic
1042814292 8:72861628-72861650 TCACCCAGCCTGCCTGCAGCAGG + Intronic
1044233693 8:89806969-89806991 GCACCCCGCCTTCCTGACCCTGG + Intergenic
1047371037 8:124256371-124256393 TCCCCCTGCCTTCCTGCACTTGG - Intergenic
1047769477 8:128019131-128019153 GCACCGTGGCTGCCTTCAGCTGG - Intergenic
1048324769 8:133430356-133430378 GCACCCTGCCTTCCTGAGGGAGG - Intergenic
1048441490 8:134462666-134462688 GCCTCCTGCCTTCCTCCAGGTGG + Intergenic
1048577090 8:135701414-135701436 GCACCCTGCTTCCCTGGAGCTGG - Intergenic
1049198914 8:141330411-141330433 GAACCCTGCCCTCCTGGAGCTGG + Intergenic
1049246043 8:141563142-141563164 CCCCCATGCCTGCCTGCAGCCGG - Intergenic
1049788926 8:144464225-144464247 GCAGCCTGTCCTCCTCCAGCCGG + Intronic
1049796606 8:144499961-144499983 GCACCCTGTCCACCTGCTGCTGG - Intronic
1049826564 8:144672542-144672564 GCACCCTGGCTGCCAGGAGCTGG + Intergenic
1049826728 8:144673865-144673887 GCAGCCTGCCCCGCTGCAGCTGG - Intergenic
1050406559 9:5314620-5314642 GTACCCTGCTTTCCTGGAACTGG + Intergenic
1050692349 9:8242154-8242176 GAAGCCTGCCTTCTTACAGCAGG - Intergenic
1053013205 9:34647111-34647133 GCACCCACTCATCCTGCAGCGGG - Exonic
1055397303 9:75889725-75889747 CCTCCCTGCCTTCCTGGAGCGGG - Intergenic
1056283333 9:85063567-85063589 GTAGGCTGCCTTCCTGCAGGTGG - Intergenic
1056929492 9:90862245-90862267 GCACCTTCCCTTCGTGCAGCAGG - Exonic
1057937586 9:99253858-99253880 CCACCTTGCCTCCCTGCAGTTGG + Intergenic
1059523228 9:114963541-114963563 GGTCCCTGACTTCCTGCAACAGG + Intergenic
1060536567 9:124393982-124394004 ACACCCTGCCCTGCTGCCGCAGG + Intronic
1060559717 9:124533074-124533096 GACCCCTGCCTGCCTGCAGAGGG + Intronic
1061152301 9:128835856-128835878 GGACCCAGCCCACCTGCAGCAGG + Exonic
1061181671 9:129028228-129028250 GCACCCCGCCCACCTGCTGCGGG + Exonic
1061231022 9:129315868-129315890 CCACCCTGGCCTCCTGCACCGGG - Intergenic
1061563403 9:131421186-131421208 CCACCCTGCACTCCTGCAGCAGG - Intronic
1062070635 9:134553391-134553413 TCACCCAACCTTCATGCAGCAGG + Intergenic
1062101909 9:134732918-134732940 GCATCCTGCCTGCCGGCGGCGGG - Intronic
1062339420 9:136087417-136087439 ACACCCTGCCCTCCTGGAGCTGG + Intronic
1062423756 9:136496781-136496803 GCACCATGCCGCTCTGCAGCCGG + Exonic
1185771410 X:2768030-2768052 GCAACCTGGCCTCCTGCTGCAGG + Intronic
1185816730 X:3163231-3163253 GCCCCCTGCCATCCTCCAGTTGG - Intergenic
1189264124 X:39700521-39700543 CCACTCTGCCTGCATGCAGCAGG - Intergenic
1189380837 X:40501000-40501022 GCACGCTGCTCTCCTGCAGGAGG - Intergenic
1190185723 X:48232199-48232221 GGTCCCTGACTTCCTGCAACTGG - Intronic
1192181471 X:68918372-68918394 GCCCCCTGCCTGCCAGCAGGGGG - Intergenic
1193521479 X:82535155-82535177 TCTTCCTGCCTCCCTGCAGCAGG + Intergenic
1193554280 X:82933452-82933474 GCTCTCTGCCTTGCTGTAGCAGG + Intergenic
1200884955 Y:8258517-8258539 GCCCCATGCCCTCCTGCTGCAGG - Intergenic
1201299142 Y:12490879-12490901 GCAACCTGGCCTCCTGCTGCAGG - Intergenic