ID: 948640209

View in Genome Browser
Species Human (GRCh38)
Location 2:239370959-239370981
Sequence CAGTGGCTCCAAAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 306}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948640209_948640215 5 Left 948640209 2:239370959-239370981 CCCTCTGCCCTTTGGAGCCACTG 0: 1
1: 0
2: 2
3: 38
4: 306
Right 948640215 2:239370987-239371009 CAGCTGCTGTCCACACCACAGGG 0: 1
1: 0
2: 1
3: 23
4: 283
948640209_948640214 4 Left 948640209 2:239370959-239370981 CCCTCTGCCCTTTGGAGCCACTG 0: 1
1: 0
2: 2
3: 38
4: 306
Right 948640214 2:239370986-239371008 GCAGCTGCTGTCCACACCACAGG 0: 1
1: 0
2: 4
3: 25
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948640209 Original CRISPR CAGTGGCTCCAAAGGGCAGA GGG (reversed) Intronic
900093929 1:932780-932802 CGCTGGCTCCAAAAGGCAGGTGG - Intronic
900178623 1:1301852-1301874 CAGCGGCTCCACAAGGCAGAAGG - Intronic
902454362 1:16521348-16521370 CCGTGGCTCCACCGCGCAGAAGG - Intergenic
902663312 1:17920437-17920459 CAGTGGAGCCATAGGGTAGAAGG + Intergenic
903339882 1:22647249-22647271 CCGAGGACCCAAAGGGCAGAAGG + Exonic
903581374 1:24373364-24373386 CAGTGGCCCCTAATGGCAGCTGG + Intronic
904604562 1:31691597-31691619 CATTGGGCCCAAAGGGCAGAAGG - Exonic
904673314 1:32181770-32181792 CAGTTGCTCCAAAACCCAGAAGG - Intronic
904905400 1:33894135-33894157 CAGTGGCTCCCCAAGGCTGAAGG + Intronic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
905261742 1:36723870-36723892 CAGTTGATGCAAAGGGCTGAAGG + Intergenic
905403317 1:37718010-37718032 CAGTGGGTACAAATGGCAGTAGG + Exonic
905467162 1:38163886-38163908 CAATGTCCCCAAAGGGCAGATGG + Intergenic
905913962 1:41672328-41672350 CAGTGGCTGCAGCGGTCAGAAGG - Intronic
906711112 1:47930544-47930566 CAGAGGCTTCAAAGGACAGCAGG + Intronic
906716307 1:47972233-47972255 CAGTGGCTCCCATGGGTAGTGGG - Intronic
909505155 1:76379769-76379791 CAGGTGCTCCACATGGCAGAGGG + Intronic
909681251 1:78294487-78294509 CTGTGGCTTCAGAGGGTAGAAGG + Intergenic
912134974 1:106649705-106649727 CAGTGGATCCAAAAGTCAAAGGG - Intergenic
912551747 1:110489532-110489554 CAGTGGCTCCAATGGCCTGCTGG - Intergenic
913220225 1:116654243-116654265 CAGAGGCTCCTGAGGGCAGCAGG + Intronic
913234423 1:116767645-116767667 CAGTGGCTCCAGAGGGAGGTAGG - Intronic
913602230 1:120432717-120432739 CAGTGGCTCCTTGGGGCTGAGGG + Intergenic
913655149 1:120953011-120953033 CAGAGGCTCCACAGCGCAGAAGG - Intergenic
914084820 1:144443921-144443943 CAGTGGCTCCTTGGGGCTGAGGG - Intronic
914190828 1:145409082-145409104 CAGTGGCTCCTTGGGGCTGAGGG - Intergenic
914363402 1:146956323-146956345 CAGTGGCTCCTTGGGGCTGAGGG + Intronic
914488274 1:148130811-148130833 CAGTGGCTCCTTGGGGCTGAGGG - Intronic
914588634 1:149085929-149085951 CAGTGGCTCCTTGGGGCTGAGGG - Intronic
914645334 1:149647171-149647193 CAGAGGCTCCACAGCGCAGAAGG - Intergenic
914790783 1:150876192-150876214 AAGCGGCTCCAGCGGGCAGAGGG + Intronic
915167703 1:153957891-153957913 CGGGGGCACCAAAGCGCAGAAGG + Intronic
916162759 1:161935392-161935414 CTGTGTCTTCAAATGGCAGAAGG - Intronic
916524319 1:165595131-165595153 CCCTGACTCCAAGGGGCAGATGG - Intergenic
916741979 1:167654204-167654226 AAGTGGCTCCCAAATGCAGAAGG + Intronic
916932852 1:169597335-169597357 CATTTGCTGCAAAGGGCAGTGGG + Intronic
917598086 1:176550014-176550036 CAGTGGTTACTAAGGGCTGAAGG - Intronic
917670086 1:177265595-177265617 CAGTGGCTCCAAACTGTACATGG + Intronic
919701515 1:200636192-200636214 TAGTGGCTCCAAGGTGAAGAAGG - Intronic
919989153 1:202697110-202697132 CATTAGCTCCTAACGGCAGATGG + Intronic
920202041 1:204265671-204265693 CAGAGGCACCAGAGAGCAGAAGG - Intronic
920234619 1:204494542-204494564 CCTAGGCTCCAAGGGGCAGAGGG + Intronic
921219533 1:212963326-212963348 CAGTGGCCCCAGTGGGCAGGGGG - Intronic
921817740 1:219583024-219583046 TAGAGGCTACAAAGGGTAGAGGG - Intergenic
922109225 1:222541261-222541283 TACTGGGTGCAAAGGGCAGAAGG + Intronic
1062886928 10:1023656-1023678 CAGAGGCTGCGAAGGGCAGTGGG + Intronic
1064230113 10:13522348-13522370 GCCTGGCTCCACAGGGCAGAGGG + Intronic
1065617995 10:27548537-27548559 CAGAGGCTGGAAAGGGAAGATGG + Intergenic
1066800238 10:39180123-39180145 CACTGTCTCCAAATGGCTGAAGG - Intergenic
1067958334 10:50818865-50818887 CAGTGGATCCAGATGGCAAAGGG - Intronic
1068410731 10:56650790-56650812 CAGTGGATCAAAAGTGCAGGAGG - Intergenic
1070368624 10:75760400-75760422 GAGTGGCTGGAAAGGGCAGCTGG + Intronic
1070787066 10:79168076-79168098 AATTGGCTCCAGAGGGTAGAGGG - Intronic
1070971375 10:80570174-80570196 CAATGGCTCCTAGGGGCAGATGG + Exonic
1071180549 10:82978747-82978769 CAGTGTCTCCAAAGGTAAAATGG + Intronic
1071386250 10:85124249-85124271 CAGTGGTTCTTAAGGGCAGGAGG - Intergenic
1073323505 10:102629575-102629597 CAAAGGCTCCAAAGGGAAGGAGG - Intronic
1076521668 10:131085111-131085133 CTGTGTCCCCACAGGGCAGAGGG - Intergenic
1076559919 10:131355442-131355464 ATGTGGGTCCAAATGGCAGAAGG - Intergenic
1079102796 11:17552127-17552149 CAGAGGCCTGAAAGGGCAGAGGG + Intronic
1081208690 11:40305159-40305181 CAGTGCCTGCAAAGAGCAGAGGG - Intronic
1081407918 11:42719339-42719361 CAGAGGCTCGAAAGGGCAGTGGG + Intergenic
1081853044 11:46287008-46287030 CAGTGGGTCCACAGGTCAGATGG + Intronic
1082584845 11:54924125-54924147 CAGTGTCTCCAAACTGCTGAAGG + Intergenic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084676649 11:70639393-70639415 TGGTGTCTTCAAAGGGCAGAAGG + Intronic
1086210221 11:84309250-84309272 CAGTGATTCCCAAGGACAGACGG - Intronic
1086601802 11:88642276-88642298 CTGAGGCTGCAAAGGGCAGCAGG + Intronic
1088754313 11:112872978-112873000 AAGTGGCTCGACAGGGCAGTGGG - Intergenic
1088830680 11:113533607-113533629 CCTTTTCTCCAAAGGGCAGAGGG - Intergenic
1088961579 11:114671605-114671627 CAGTGGCACCAGAAGGCAGTAGG + Intergenic
1088995060 11:114989022-114989044 CAAGGGCAGCAAAGGGCAGATGG + Intergenic
1089460408 11:118649928-118649950 CTGTGGCTCCACAGGGCTTATGG - Intronic
1089901629 11:121992601-121992623 CAGGAGCTCCCAAGGACAGATGG - Intergenic
1090175682 11:124647394-124647416 CCGTGGTTCCCAGGGGCAGACGG - Exonic
1090343261 11:126044732-126044754 CAGAGGCTCAGAAGGGCAGCAGG + Intronic
1090603234 11:128394291-128394313 TGGAGGCTCCAAAGGCCAGAGGG + Intergenic
1090653422 11:128825255-128825277 CAGTGGCTCCAGAGAGGTGAGGG - Intergenic
1091435196 12:466595-466617 TAGTGGCTCTAAAGGGCACTGGG + Intronic
1093711436 12:22334133-22334155 CACTGGCTCCCATGGGCAGCCGG + Exonic
1095304832 12:40626884-40626906 CAGTGGCTTCAATAGGTAGAGGG - Intergenic
1098569939 12:71976952-71976974 CAGTGGTTACAAGGGGCAGGAGG + Intronic
1098996021 12:77120891-77120913 AAGTAGCTACAATGGGCAGAGGG + Intergenic
1101138427 12:101770020-101770042 CAGTCACTCCAAAGGCCAGAAGG - Exonic
1101471210 12:104998974-104998996 CAGTGGCTGCACAGGGCGCAGGG + Intronic
1102612509 12:114124852-114124874 CTGAGGCTCAGAAGGGCAGATGG - Intergenic
1103746975 12:123131585-123131607 CAGAGGCTCCAGGAGGCAGAGGG + Intronic
1103965805 12:124638631-124638653 CAGTGGGTCCGAAGAACAGAGGG + Intergenic
1104081483 12:125434185-125434207 CCGTGGCTGCAGAGGTCAGAGGG - Intronic
1104754435 12:131260289-131260311 CAGGGGCTCCACTGGTCAGAGGG - Intergenic
1105583348 13:21721386-21721408 CAGTGCCTTCAAAGGGCCAAAGG + Intergenic
1106198130 13:27511327-27511349 CAGAGGTTGCAAAGGGCTGAGGG - Intergenic
1106548293 13:30749630-30749652 TAGGAGCTCCAAAGGGCAGGAGG - Intronic
1106818036 13:33430899-33430921 CAGAGGCTACAAAGGATAGAAGG + Intergenic
1109797231 13:67331683-67331705 AAGTGGCTCCAAAGGGAAGGGGG - Intergenic
1110514825 13:76397672-76397694 GGGTGGCTCAAAAGGTCAGATGG + Intergenic
1110720648 13:78757751-78757773 CAGTGCCTCCAAATCACAGATGG - Intergenic
1113432362 13:110261922-110261944 CAGTGGCTGCACAGGGCAGGTGG + Intronic
1113679181 13:112230692-112230714 AACATGCTCCAAAGGGCAGAGGG + Intergenic
1113988801 13:114341792-114341814 CAGTGGCTCCAAGGATGAGAAGG - Intergenic
1114339103 14:21724270-21724292 GAGTCGCTCACAAGGGCAGATGG - Intergenic
1115289426 14:31753227-31753249 CAGTGGCTCCACTGGTCACAGGG + Intronic
1115916582 14:38321603-38321625 CTGAGGCTGCACAGGGCAGAAGG + Intergenic
1116441923 14:44963319-44963341 TAGTGTCTCCTCAGGGCAGAGGG - Exonic
1117718118 14:58601442-58601464 CAGTGGCATCAACTGGCAGATGG - Intergenic
1119106015 14:71924558-71924580 CAGTGGTTACCAAGGGCAGGTGG - Intergenic
1120722200 14:87901443-87901465 CAGTGGCTGGAAACTGCAGAGGG + Intronic
1121580485 14:95026082-95026104 GAGTGGTTCCCCAGGGCAGAGGG + Intergenic
1121626764 14:95390876-95390898 CTGTGGCACCACATGGCAGAAGG - Intergenic
1122191198 14:100045107-100045129 CAGTGGCTCCCAACTGCAGACGG - Intronic
1122638058 14:103139349-103139371 CAGCGCCCCCGAAGGGCAGAGGG - Intergenic
1122776750 14:104120334-104120356 CACTGGCTTTAAAAGGCAGAAGG - Intergenic
1122953980 14:105061411-105061433 CAGAGGCTCCCAGGGGCAGTAGG - Intronic
1124406944 15:29401504-29401526 CAGTGATGGCAAAGGGCAGAGGG + Intronic
1124431372 15:29611564-29611586 AAGTGGCTGGGAAGGGCAGAGGG - Intergenic
1124661984 15:31557454-31557476 CAGTGCCTCTTAATGGCAGAAGG - Intronic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1126117911 15:45225739-45225761 CTGTGTCCTCAAAGGGCAGAGGG + Intergenic
1130370080 15:83277864-83277886 AAGTAGCTCCAAAGAGCAGTGGG - Intronic
1131577000 15:93602227-93602249 TAGAGGCTGCAAAGGGAAGATGG - Intergenic
1132222054 15:100112382-100112404 CAGAGGCCTCAAAGGGGAGACGG - Intronic
1132279728 15:100602588-100602610 CAGTGACCCCAAAGTGCTGAAGG + Exonic
1132607888 16:801035-801057 CAGAGGCTTCAGAGGGCAAAGGG - Intergenic
1132761099 16:1509039-1509061 CAGTGGCTCCACTGGCCAAAGGG - Intronic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1133558224 16:6925634-6925656 TAGTGGCTACAAAGGGCTTAGGG + Intronic
1135087757 16:19488494-19488516 CAGTGGAGCCAAAGGGAAGTGGG - Intronic
1137562359 16:49510963-49510985 GACAGGCTCCAATGGGCAGACGG + Intronic
1137810781 16:51350501-51350523 CAGTGGCTGAAAAGATCAGAGGG + Intergenic
1139320067 16:66107121-66107143 CAGGGACTCCAACAGGCAGAGGG - Intergenic
1141309110 16:82895903-82895925 CAGTGTGTTCAAAGAGCAGAGGG - Intronic
1141382906 16:83591746-83591768 AAGTGGCTCCCCAGGGCAGCAGG - Intronic
1141748883 16:85945129-85945151 CAGAGGCTCCAAATGGGAGATGG - Intergenic
1142291226 16:89194469-89194491 CAGAGCCTCCGAAAGGCAGACGG + Intronic
1143393897 17:6576746-6576768 CAGTGGGTCTGAAAGGCAGAAGG - Intergenic
1143419221 17:6776075-6776097 CAGTGGATCCCATGTGCAGAGGG - Intergenic
1143944880 17:10582027-10582049 CAGTGGCTGCCAAGGGCTAAAGG - Intergenic
1145096371 17:20031671-20031693 CAGTGGTTGCCAAGGGCTGAGGG - Intronic
1146077395 17:29744092-29744114 CAGGGACGCCAAAGGGCAGTGGG + Intronic
1146308893 17:31751842-31751864 CAGTGGTTACCAAGGGCTGAAGG + Intergenic
1147944937 17:44075596-44075618 GAGTGGGCCCCAAGGGCAGATGG + Intronic
1148350397 17:46937597-46937619 CAGTGGCTGCCTGGGGCAGAGGG - Intronic
1148563198 17:48618061-48618083 CAGGGGCTCCCCAGGGCAGCAGG - Intronic
1149854903 17:60073745-60073767 CAATGGCTCCAAATGTCAAAAGG - Exonic
1150077628 17:62206735-62206757 CAGGGGCACCAAAGGGCAGCTGG - Intergenic
1150796302 17:68240154-68240176 CAGTGGCCTCACATGGCAGAAGG + Intergenic
1151668756 17:75560029-75560051 CTGTGGTTCCAAGGGGCAGGAGG + Intronic
1152191284 17:78889577-78889599 CAGGGGCACCCAAGGTCAGACGG - Intronic
1152218391 17:79047614-79047636 CACTGGACCCAAAGGGCAGAAGG + Exonic
1152322011 17:79612957-79612979 AGGAGGCTCCAAAGGGCAGTAGG - Intergenic
1152813571 17:82393855-82393877 CAGAGGCACCAAAGGACAGGGGG + Intronic
1153614907 18:6925367-6925389 GAGGGGCTCCAAAGGGCATGGGG + Intergenic
1155295842 18:24384013-24384035 CAGTGGCTGCACAGAGGAGAAGG + Intronic
1157490246 18:48118376-48118398 CAGTGGCACAAAAGGGGAAAAGG - Intronic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1157797483 18:50588398-50588420 GACTGGCTTCACAGGGCAGAAGG + Intronic
1160370176 18:78365562-78365584 CAGTGGCTCCAAGGAGAAGAGGG + Intergenic
1161668006 19:5588697-5588719 CTGTGGCTACCAAGGGCAGGGGG + Intronic
1162195022 19:8977952-8977974 CTGTGGTTCCAATGGGCAGATGG + Exonic
1162219026 19:9160429-9160451 GCGTGGCTCCTAAGGGCTGAAGG - Exonic
1162373594 19:10292646-10292668 CAGCGTCTCCGAGGGGCAGATGG + Exonic
1163585308 19:18160712-18160734 GAGTGACTCCTAAGGGAAGATGG + Intronic
1163721730 19:18901096-18901118 AGGTGGCTCCAAAGGGAAGTGGG + Intronic
1164479155 19:28598185-28598207 CAGTGATTCCAAAAGGCAGGAGG + Intergenic
1164502368 19:28830909-28830931 CAGTGTCTTCAAGGGGCAAACGG - Intergenic
1164838627 19:31375380-31375402 CAGTGGCTCCCAGGGGCAAGGGG - Intergenic
1165064197 19:33219593-33219615 CAGTGGCCCCACCTGGCAGATGG - Intronic
1165292677 19:34900939-34900961 CAGTGGCTTCCAAGGGTTGAAGG + Intergenic
1165840346 19:38785483-38785505 CAGTGGCTTCATGTGGCAGAAGG + Intergenic
1166213505 19:41321750-41321772 CAGCAGCACCAAGGGGCAGAAGG + Intronic
1166891732 19:45998231-45998253 TTGTGGCGCCCAAGGGCAGAAGG + Intronic
924958986 2:17089-17111 CAGTGGCGCCAAGGATCAGAAGG + Intergenic
926507145 2:13731261-13731283 CAGTGACTCCAAAAGGGAGAAGG - Intergenic
926768987 2:16351349-16351371 CAGAGGCTGCACAGGGCAGCAGG - Intergenic
928600569 2:32900245-32900267 GAGTGGGTCCAATGGGCAGAGGG - Intergenic
930021381 2:47004061-47004083 CAGGAGCTCCAAAGGGTTGAAGG - Intronic
930704654 2:54492531-54492553 CAGTTGGTGCAAAGGGCAGTAGG - Intronic
931434776 2:62236704-62236726 CAGTGGGGTCAAAGGGCAAAAGG - Intergenic
931557298 2:63519245-63519267 CAGTGGCTCTGCAGGGCAGAGGG - Intronic
932214426 2:69957775-69957797 CAGTGGTCCCAAAGTGCAGCAGG - Intergenic
933834976 2:86238690-86238712 CTGTGGGTGCACAGGGCAGAAGG + Intronic
936583838 2:113733601-113733623 CGGTTGCTCCAATGGGCAGCTGG - Intronic
938318412 2:130345795-130345817 CAGTAGGACCAAAGGGCAGGTGG - Exonic
938824957 2:134995444-134995466 CAGTGGATCCAGAGAGCAGGTGG + Intronic
940510167 2:154603830-154603852 AAGTGGCTCCAAATGGCCAAGGG + Intergenic
943416323 2:187610562-187610584 AAGTGGATCCAGGGGGCAGAGGG - Intergenic
943475748 2:188353529-188353551 CAGTGACTACAATGGGTAGATGG - Intronic
945248421 2:207742544-207742566 CAGTTGCTACAAAAGGCAGCCGG + Intronic
945664758 2:212726681-212726703 CAGAGGCTCCAAAGAGCTGTAGG + Intergenic
946033723 2:216725270-216725292 CAGTGGCTCCAACCTGCAGAGGG + Intergenic
947229775 2:227872919-227872941 CACTGGCTCCTAGTGGCAGATGG - Intronic
947295879 2:228629490-228629512 CTGTTGCTTCAAAGGGCAAAAGG + Intergenic
947519811 2:230836857-230836879 CAGTGGCAGCAAAGTGCAGGGGG - Intergenic
948640209 2:239370959-239370981 CAGTGGCTCCAAAGGGCAGAGGG - Intronic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1170816693 20:19720311-19720333 CAATGCCTCCAGAGGGGAGAGGG - Intronic
1171383154 20:24748325-24748347 CAGAGCCTCCAAAAGGCAGAGGG + Intergenic
1172539253 20:35698644-35698666 CATGGCATCCAAAGGGCAGAAGG + Intronic
1173220215 20:41126211-41126233 TAGTGGCTGGAAAGGGCTGAGGG - Intergenic
1175629310 20:60519913-60519935 CAGTGTCTACATAGGGCTGATGG - Intergenic
1175653198 20:60746776-60746798 CTGTGGCTTCATAGGGCAAATGG - Intergenic
1175960085 20:62631510-62631532 CGGTGGCTCCCAGGGGCAGCCGG + Intergenic
1176413348 21:6460851-6460873 CAATGGCTGCAAAGCGCAGGCGG + Intergenic
1178743522 21:35225887-35225909 CAGTGGCTCTGAGGGGCAGGTGG + Intronic
1179688845 21:43069174-43069196 CAATGGCTGCAAAGCGCAGGCGG + Intronic
1179712030 21:43268954-43268976 CAGTTACTCCAAGGGGCTGACGG - Intergenic
1180244776 21:46539642-46539664 CTGGTGCTCCAAAGGGCAGAAGG - Intronic
1180615307 22:17122165-17122187 CAAAGGCTCCAAAGGGATGATGG + Intronic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1180821525 22:18832262-18832284 CAGAGGCTCCTGAGGGCAGCAGG + Intergenic
1180874835 22:19170309-19170331 CAGGGACCCCAAAGGGAAGATGG - Intergenic
1181024345 22:20119400-20119422 CAGTGGCAAAAAAGGGCAGTGGG - Intronic
1181191453 22:21143783-21143805 CAGAGGCTCCTGAGGGCAGCAGG - Intergenic
1181207745 22:21266727-21266749 CAGAGGCTCCTGAGGGCAGCAGG + Intergenic
1181536251 22:23547642-23547664 CACATGCTTCAAAGGGCAGAAGG - Intergenic
1183214323 22:36469319-36469341 CAGTGGCTACAGAGGGCACAAGG + Intronic
1183320952 22:37164729-37164751 CCGAGGCTCCAGAGAGCAGAGGG + Intronic
1185099108 22:48828193-48828215 GAGAGGCTGCAAAGGACAGAAGG - Intronic
1203219175 22_KI270731v1_random:28689-28711 CAGAGGCTCCTGAGGGCAGCAGG - Intergenic
1203271650 22_KI270734v1_random:58138-58160 CAGAGGCTCCTGAGGGCAGCAGG + Intergenic
950626133 3:14248513-14248535 GAGTGGTTCAAAAGGGTAGAGGG - Intergenic
952662300 3:35866373-35866395 TAGAGGTTCCCAAGGGCAGAGGG + Intergenic
953788525 3:45929228-45929250 CAGTGACACCAGGGGGCAGAAGG - Intronic
954910019 3:54096720-54096742 GAGAGGCTCCAAAGGGAAGGCGG + Intergenic
955978079 3:64497410-64497432 TAGAGGCACCAAAGAGCAGATGG + Intergenic
956139016 3:66127059-66127081 CAGTGGCTCCAAGGGGCCACTGG + Intergenic
956923106 3:73951719-73951741 CAGTTGCACCAAATGGCTGATGG - Intergenic
958107929 3:89102323-89102345 CAGAGTATCCAAAAGGCAGAAGG - Intergenic
958873433 3:99588897-99588919 CAGTGACCCCAAAAGGCTGATGG - Intergenic
960696095 3:120398069-120398091 TAGTGGCTGCAAAGGGCTGGAGG + Intronic
963071524 3:141308907-141308929 CAGTGGGACAAAAGGGCAGCTGG - Intergenic
966098275 3:176232972-176232994 CAGTGGTTACCAAGGGTAGAAGG + Intergenic
966137360 3:176714080-176714102 CAGAGGCTTCCAAGGGAAGATGG + Intergenic
966241370 3:177758109-177758131 CTGAGGCTGCAAAGGGCAGTGGG + Intergenic
966937825 3:184725414-184725436 CTGTGGAGCCAAAGGCCAGATGG + Intergenic
967564630 3:190959350-190959372 CTGAGGCTGCAAAGAGCAGAGGG - Intergenic
967967949 3:194976980-194977002 AGTTGGCTACAAAGGGCAGAAGG - Intergenic
968374461 4:27497-27519 CAGTGGCTCCAAGGATGAGAAGG + Intergenic
968452048 4:680441-680463 CCGTGGCTGCCAAGGGCAGATGG - Intronic
968658563 4:1789332-1789354 CAGGGGGTCCCATGGGCAGAAGG + Intergenic
969538134 4:7769200-7769222 CAGAGGCTCCGACGGGCAGGTGG + Intronic
970902719 4:21178196-21178218 TGGTGGCTCCAAAGGGCACAAGG + Intronic
975296326 4:72738487-72738509 CAGTAGCTACAAAGGGCTGGGGG - Intergenic
978352881 4:107838892-107838914 CAGTGGCTACAGAAGGCAGATGG - Intronic
978769272 4:112437010-112437032 CAGTGAATCCTAAGGACAGAAGG + Intronic
979539470 4:121865049-121865071 TAGAGGCTGCAAAGGGTAGAGGG - Intronic
981203242 4:142008631-142008653 CAGAGGCTGAAAAGGGCAGTGGG - Intergenic
981286043 4:143020212-143020234 CAGTGACTCAGAAGGGCATATGG + Intergenic
984585527 4:181560207-181560229 CTGTGGCTTCACATGGCAGAAGG + Intergenic
985543975 5:500112-500134 CTGTGGGTTGAAAGGGCAGAGGG + Intronic
987878558 5:23711717-23711739 CAGTGACTGCAAAGCGCTGAAGG - Intergenic
987918885 5:24252142-24252164 CCTTGTCTCCACAGGGCAGAAGG + Intergenic
989740563 5:44766282-44766304 CAGTGCACCCAAAGGCCAGAAGG - Intergenic
990316017 5:54583992-54584014 CAGTGGCTCCTCAGGCCAGGAGG + Intergenic
990590235 5:57255096-57255118 TAGTGGCTTCAAATGGCAGAGGG - Intronic
997022076 5:130013664-130013686 CTGAGGCTGCAAAGAGCAGAGGG + Intronic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
999551877 5:152696628-152696650 CAGAGGCTGGAAAGGGGAGAGGG - Intergenic
1000407767 5:160906899-160906921 CAGTGGCTTAAAAGGGCAGAGGG - Intergenic
1001869632 5:175139962-175139984 ACGGGGCTCCAAAGGGGAGAGGG + Intergenic
1002522217 5:179798213-179798235 CAGTGCTTCCAGAGGGCCGAAGG + Exonic
1002755446 6:155546-155568 CAGTGGCTCCAAGGATGAGAAGG + Intergenic
1003403032 6:5806638-5806660 CTGAGGCTGCACAGGGCAGAGGG - Intergenic
1004505617 6:16244510-16244532 CAGGGGCTCAAAAGTGCAAATGG - Intronic
1005036639 6:21561389-21561411 CAGAGGCTACGAAGGGCAGTGGG - Intergenic
1009063462 6:58425932-58425954 CAGTGTTTCCAAATGGCTGAAGG + Intergenic
1009251127 6:61300518-61300540 CAGTGTTTCCAAATGGCTGAAGG + Intergenic
1011750353 6:90449099-90449121 CAGAGGCACCAATGGGCAGATGG - Intergenic
1011757098 6:90510845-90510867 CATTGCCGCCAAAGGGAAGAGGG - Intergenic
1014402127 6:121003216-121003238 CAGAGGCTGCAAAGGGTAGTGGG + Intergenic
1015283225 6:131456583-131456605 CCGTGGGTCCCAAGAGCAGAAGG + Intergenic
1015584671 6:134763350-134763372 CAATGGGTAGAAAGGGCAGATGG + Intergenic
1015726623 6:136306046-136306068 CACTGGCTCCAAAGGAAAGAGGG - Intergenic
1016510013 6:144831790-144831812 CAGTGTCACCCAAGGGCAGATGG - Intronic
1017058333 6:150457425-150457447 TACGGGCTCCAGAGGGCAGAGGG + Intergenic
1017718541 6:157228846-157228868 CTGTGACTCCACAGGACAGAAGG - Intergenic
1017739071 6:157389768-157389790 CAGTGGGTACAAAGGGTGGAAGG - Intronic
1018790501 6:167144229-167144251 CATTGGCTGCATAGGGCACAGGG - Intergenic
1018862716 6:167722766-167722788 CTCTGGCTCCCCAGGGCAGAGGG + Intergenic
1018931351 6:168242270-168242292 CACAGGCTCCACAGGGCAGAGGG - Intergenic
1019519632 7:1454832-1454854 CAGTGGCTCCCAAGGGTGGCGGG - Intronic
1020257508 7:6510340-6510362 CAGCAGCTTCAAAGGGAAGATGG - Exonic
1022464497 7:30644195-30644217 TAGTGGTGCCAAAGAGCAGAGGG + Intergenic
1022751316 7:33229392-33229414 CAGTGGTTTCCAGGGGCAGATGG - Intronic
1023630143 7:42155586-42155608 CATTTGCTCCAAAGAGCAGCAGG + Intronic
1023631771 7:42172252-42172274 TAACTGCTCCAAAGGGCAGAGGG + Intronic
1023923762 7:44650033-44650055 CAGTGGTTCCAAAGGGCTCCTGG - Intronic
1029484134 7:100828929-100828951 CAGCCCCTCCAAGGGGCAGAAGG + Intronic
1030941212 7:115651627-115651649 CTGTGTCTCCAAATGGCAAAGGG - Intergenic
1031201913 7:118699255-118699277 CAGTTTCTACAAAGGGCAAACGG + Intergenic
1031371627 7:120974768-120974790 CAGAGGCACCAAAAGGCAAATGG + Exonic
1032552694 7:132799921-132799943 CAGTGGCACCAAAGGCCCAAGGG + Intronic
1032648646 7:133853994-133854016 CACTGCCTCCAGAGGGCAAATGG - Intronic
1034452427 7:151144145-151144167 CAATGGCACCTTAGGGCAGAGGG - Exonic
1034682010 7:152936081-152936103 AAGAGGCTCAAATGGGCAGACGG - Intergenic
1035673660 8:1439391-1439413 CAGAGGCTCCGGAGGGCACAGGG - Intergenic
1036149003 8:6280835-6280857 CAGTAGCTCCACAGGGTACAAGG + Intergenic
1036590740 8:10165743-10165765 CAATGCCTCCAATTGGCAGATGG - Intronic
1038223650 8:25634316-25634338 TAGTGGTTTCCAAGGGCAGAGGG - Intergenic
1038490330 8:27965992-27966014 CAGTAACTGCAAAGGGCAGCAGG + Intronic
1039038603 8:33385514-33385536 CACAGGCTCCTAAGGGAAGAGGG + Intronic
1039848386 8:41342314-41342336 GAGTGGCTTCAAAGGGTTGAGGG - Intergenic
1039996406 8:42537766-42537788 CAGTGTCTCTAAACTGCAGAAGG - Intronic
1040570452 8:48604604-48604626 TAGTGGCTTCAAAAAGCAGATGG - Intergenic
1041491471 8:58438024-58438046 CAGAGGCTGCACAGGGCAGCTGG - Intronic
1042117440 8:65447551-65447573 CTGTGGCTACAAGGGGCAAAGGG + Intergenic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1045606078 8:103778410-103778432 CAGAGGCCAGAAAGGGCAGAGGG - Intronic
1048236610 8:132697181-132697203 AAGTGACTGCAAATGGCAGAGGG + Intronic
1048451913 8:134540978-134541000 CACTGGCACCAGAGGGGAGAGGG + Intronic
1048565920 8:135597181-135597203 CAGTGTCCCCACAGGGCAGAAGG + Intronic
1049801368 8:144518950-144518972 CAGTGGCTCTCCAGGGAAGAGGG + Intronic
1050019766 9:1270720-1270742 CAGAATCTCCTAAGGGCAGAAGG - Intergenic
1051034880 9:12732304-12732326 CAGTGGCTGCAAAGGATATAGGG + Intergenic
1051644992 9:19259249-19259271 CAGACGCTGCAAAGGGCAGTGGG - Intronic
1052787344 9:32841625-32841647 CTGGAGCTCTAAAGGGCAGAAGG - Intergenic
1057700453 9:97360175-97360197 CAGTAGAGCCAAAGGGAAGAGGG + Intronic
1058166179 9:101621830-101621852 TAGTAGCTCCTAATGGCAGAAGG + Intronic
1059006832 9:110411584-110411606 CAATGTCTCCAAAGAGCCGATGG + Exonic
1059235464 9:112757155-112757177 TAGTGGCTACCAAGGGCAGGTGG - Intronic
1061001387 9:127904821-127904843 CAGAGGCTGGAGAGGGCAGACGG + Intronic
1061307121 9:129738564-129738586 GAGTCCCTCCAAAGGGCAGTGGG - Exonic
1061721912 9:132557167-132557189 CAGGGGCTCCAAGGTGCAGACGG + Intronic
1062173382 9:135147738-135147760 CAGAGGCTCCACATGGCAGGCGG + Intergenic
1062231537 9:135484718-135484740 CAGAGGGGCCACAGGGCAGAGGG + Exonic
1062566533 9:137166218-137166240 TCTGGGCTCCAAAGGGCAGAAGG - Intronic
1203574762 Un_KI270744v1:166654-166676 CAGTGGCTCCAAGGATGAGAAGG - Intergenic
1189384874 X:40529086-40529108 CAGAGGCTGGAAAGGGTAGAGGG + Intergenic
1189852180 X:45188753-45188775 CAGTGGTTGCCAAGGGCTGAGGG - Intronic
1190339670 X:49286536-49286558 GTGTGGCTCCCATGGGCAGAGGG + Exonic
1191130520 X:57003563-57003585 CAGAGGCTACAAAGGGAAGTGGG - Intergenic
1191687923 X:63911635-63911657 CAGTGGCTGCCAAGGGAAAAAGG + Intergenic
1193527536 X:82612057-82612079 CTGAGGCTGCAAAGGGCAGAGGG - Intergenic
1193642806 X:84032717-84032739 CAGTGGCTGGGAAGGGCAGTGGG - Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1194530763 X:95045569-95045591 CACTGGCACCAAAGGCCACAGGG - Intergenic
1195284849 X:103374705-103374727 CATTCGCACCAAAGGGTAGATGG + Intergenic
1195949396 X:110251605-110251627 CAATGGCTTCAAAGGGAAGCAGG + Intronic
1196417497 X:115487155-115487177 TAGTGGTTGCAAAGGGCTGAGGG + Intergenic
1196898422 X:120360280-120360302 CAGTGGCTACAAAGGGACAAGGG - Intergenic
1197309834 X:124891138-124891160 CAGGGGCTGAAAAGGGTAGAGGG + Intronic
1199339034 X:146654326-146654348 CAGTGGGTCCAAAGGCCTGAAGG + Intergenic
1199442685 X:147886325-147886347 CAGAGGCTGCAAAGGGTAGTGGG - Intergenic
1199758741 X:150889247-150889269 GAGTGGATCTGAAGGGCAGATGG - Intronic
1200055838 X:153460233-153460255 CAGTGGCTGCCAAGGCCTGAGGG + Intronic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic