ID: 948640796

View in Genome Browser
Species Human (GRCh38)
Location 2:239375006-239375028
Sequence TAGCTCACACCCACCCGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948640796_948640801 13 Left 948640796 2:239375006-239375028 CCTGGACGGGTGGGTGTGAGCTA 0: 1
1: 0
2: 0
3: 9
4: 105
Right 948640801 2:239375042-239375064 GTTGCCTGCTGCGGGCAGGAAGG 0: 1
1: 0
2: 4
3: 12
4: 244
948640796_948640799 5 Left 948640796 2:239375006-239375028 CCTGGACGGGTGGGTGTGAGCTA 0: 1
1: 0
2: 0
3: 9
4: 105
Right 948640799 2:239375034-239375056 ACTCAGGAGTTGCCTGCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 226
948640796_948640802 14 Left 948640796 2:239375006-239375028 CCTGGACGGGTGGGTGTGAGCTA 0: 1
1: 0
2: 0
3: 9
4: 105
Right 948640802 2:239375043-239375065 TTGCCTGCTGCGGGCAGGAAGGG 0: 1
1: 0
2: 1
3: 21
4: 210
948640796_948640804 24 Left 948640796 2:239375006-239375028 CCTGGACGGGTGGGTGTGAGCTA 0: 1
1: 0
2: 0
3: 9
4: 105
Right 948640804 2:239375053-239375075 CGGGCAGGAAGGGCAGCCGCAGG 0: 1
1: 0
2: 2
3: 45
4: 380
948640796_948640805 25 Left 948640796 2:239375006-239375028 CCTGGACGGGTGGGTGTGAGCTA 0: 1
1: 0
2: 0
3: 9
4: 105
Right 948640805 2:239375054-239375076 GGGCAGGAAGGGCAGCCGCAGGG 0: 1
1: 0
2: 2
3: 58
4: 525
948640796_948640798 4 Left 948640796 2:239375006-239375028 CCTGGACGGGTGGGTGTGAGCTA 0: 1
1: 0
2: 0
3: 9
4: 105
Right 948640798 2:239375033-239375055 GACTCAGGAGTTGCCTGCTGCGG 0: 1
1: 0
2: 0
3: 17
4: 210
948640796_948640800 9 Left 948640796 2:239375006-239375028 CCTGGACGGGTGGGTGTGAGCTA 0: 1
1: 0
2: 0
3: 9
4: 105
Right 948640800 2:239375038-239375060 AGGAGTTGCCTGCTGCGGGCAGG 0: 1
1: 0
2: 2
3: 16
4: 179
948640796_948640806 26 Left 948640796 2:239375006-239375028 CCTGGACGGGTGGGTGTGAGCTA 0: 1
1: 0
2: 0
3: 9
4: 105
Right 948640806 2:239375055-239375077 GGCAGGAAGGGCAGCCGCAGGGG 0: 1
1: 0
2: 3
3: 62
4: 620

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948640796 Original CRISPR TAGCTCACACCCACCCGTCC AGG (reversed) Intronic
901226096 1:7613771-7613793 CTGCTCCCACCCACCCCTCCAGG - Intronic
912463435 1:109852857-109852879 TAGCTCACACCCAACCAATCAGG - Intergenic
919781878 1:201226291-201226313 TGCCTCACACCCACCTGTTCTGG + Intronic
1069076783 10:64045390-64045412 TAGCTCACACCCAACCAATCAGG + Intergenic
1074565480 10:114573684-114573706 TAGTCCACTCCCACCCATCCAGG + Intronic
1076189430 10:128472566-128472588 TGGCAGAAACCCACCCGTCCAGG + Intergenic
1076454762 10:130582928-130582950 TATCTCACACCCACCAGCCCTGG - Intergenic
1076674070 10:132138792-132138814 CTGCTCACACTCACCCATCCTGG + Intronic
1077301958 11:1851609-1851631 TTCCGCTCACCCACCCGTCCAGG - Intergenic
1085601290 11:77858502-77858524 TAGCTCACACCCAACCAATCAGG - Intronic
1088828470 11:113515522-113515544 TAGCTAACTCCTACCCATCCTGG - Intergenic
1092197916 12:6561123-6561145 TTGCTCCCACCCTCCTGTCCAGG + Intronic
1095552438 12:43458893-43458915 TAGCTCACACCCAACCAATCAGG + Intronic
1096111485 12:49031680-49031702 CAGCTCCCTCCCACCCATCCAGG - Exonic
1103799221 12:123526482-123526504 ATCCTCACACCCACCCTTCCCGG - Intronic
1104105658 12:125656728-125656750 TAGCTCAGAGCCAACCATCCAGG + Exonic
1104851008 12:131873845-131873867 TAGCTCACACCCACCCCGTCAGG - Intergenic
1104852004 12:131880831-131880853 TAGCTCACACCCAACCAATCAGG - Intergenic
1105857824 13:24387622-24387644 TATCTCCCACCCACCTCTCCTGG + Intergenic
1116661626 14:47717390-47717412 GAGCGCACACACACCTGTCCAGG + Intergenic
1116986452 14:51224767-51224789 TACCTTCCACCCACCCTTCCTGG - Intergenic
1121955038 14:98205828-98205850 TAGCACACACCCACCAGTGTGGG - Intergenic
1202926504 14_KI270724v1_random:31094-31116 TTGCTCACTCTCACCCTTCCTGG - Intergenic
1126728380 15:51655920-51655942 TAGCTCACACCCAACCAGTCAGG - Intergenic
1128797147 15:70474334-70474356 CAGCTCTAACCCACCCCTCCCGG + Intergenic
1130827870 15:87567924-87567946 TAGCTCTCACCCATGCGTTCTGG - Intergenic
1132756003 16:1485828-1485850 AAGGCCACCCCCACCCGTCCTGG - Intergenic
1136176530 16:28520915-28520937 TGGCTCACACCCACCTCTGCAGG + Intergenic
1139341567 16:66271005-66271027 CAGCTCACACCTTCCCATCCTGG + Intergenic
1139449227 16:67016790-67016812 TAGCACACTCCCACCCAGCCAGG + Intergenic
1139633951 16:68246720-68246742 TACTTGACACCCACCCATCCAGG - Intronic
1144613993 17:16751862-16751884 TAGCTCGCACTCACCCAACCAGG + Intronic
1144641582 17:16940116-16940138 CACCCCACACCCACCCTTCCCGG + Intronic
1146480702 17:33202799-33202821 AAGGTCACCCCCACCCATCCAGG - Intronic
1148827624 17:50405580-50405602 TAGCTCACACCCAACCAATCAGG - Intergenic
1150613036 17:66748997-66749019 TACCTAATACCCGCCCGTCCTGG - Intronic
1150613073 17:66749157-66749179 TACCTAATACCCGCCCGTCCTGG - Intronic
1150849986 17:68695226-68695248 TAGCACACCCCCACCCTCCCAGG - Intergenic
1151650928 17:75469001-75469023 CAGCCCTCACCCTCCCGTCCTGG - Intronic
1151803153 17:76389411-76389433 TCCCTCACACACACCCTTCCTGG - Intergenic
1153139443 18:1954769-1954791 AAGCTCACACACACCCAGCCGGG + Intergenic
1155220792 18:23683919-23683941 TATGTCCCACCCACCCTTCCAGG + Intergenic
1156270628 18:35527149-35527171 TATCTCCCACCCAACCCTCCAGG + Intergenic
1158390788 18:57043380-57043402 TAGGTCACACCCAGACCTCCTGG + Intergenic
1159292375 18:66439687-66439709 AAGCACACACACACCCGGCCAGG - Intergenic
1160619907 18:80163502-80163524 CAGTTCACAGCCACCCATCCCGG + Intronic
1160882165 19:1325856-1325878 TAGCTCACACCCGCCGGGCACGG + Intergenic
1162901371 19:13796885-13796907 TGGCCCAAACCCATCCGTCCAGG - Intronic
1164686873 19:30172487-30172509 CAGCTCACTCCCACCTGTCGTGG - Intergenic
1165662530 19:37594366-37594388 AAGCGCACACGCACACGTCCAGG + Intronic
1166776795 19:45317979-45318001 GACCTCACCCCCACCCCTCCAGG - Exonic
1167314257 19:48754899-48754921 CTGCTCACACCCAGCAGTCCAGG + Intronic
1168147053 19:54425523-54425545 TAGCTCACACCCAACCAATCAGG - Intronic
935210223 2:100933276-100933298 TACCTCGAACCCACCCTTCCTGG - Intronic
935236214 2:101140427-101140449 TAGCTGACACACAGGCGTCCGGG + Intronic
936868856 2:117109380-117109402 TAGCTCACACCCGACCGATCAGG + Intergenic
942374858 2:175326303-175326325 TAGCTCACACCCAACCAATCAGG + Intergenic
942565858 2:177264475-177264497 TAGCTCCCCCGCCCCCGTCCCGG + Intronic
944416869 2:199487787-199487809 TAGTTCTCACCCACACATCCAGG - Intergenic
946395838 2:219443281-219443303 TATCTACCACCCACCCGACCAGG + Intronic
948640796 2:239375006-239375028 TAGCTCACACCCACCCGTCCAGG - Intronic
1169273359 20:4217188-4217210 TAGCTCACACCCAGTCATCCTGG - Intergenic
1170612960 20:17929218-17929240 GAGCCCACACCTACCCCTCCAGG + Intergenic
1172446700 20:34997025-34997047 TAACTCCCACCCACCCGCCTGGG - Intronic
1179929413 21:44557552-44557574 TCCCCCACACCCACCCGGCCCGG - Intronic
1182415378 22:30217925-30217947 TCCCTCTCACCCACCCGCCCTGG - Intergenic
951246749 3:20350073-20350095 TAGCTCACTCCCTCACCTCCTGG + Intergenic
951869163 3:27341192-27341214 TTGCACTCACCCACCCTTCCTGG - Intronic
952885116 3:38007254-38007276 GAGCTCACACCCGCCAGCCCTGG - Intergenic
953406479 3:42662400-42662422 AAGCTCACAGACACCAGTCCTGG - Intronic
957296945 3:78344548-78344570 TAGCTCACACCCAACCAATCAGG - Intergenic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
971198702 4:24492605-24492627 TCATTCACACCCACCCGTCCAGG - Intergenic
975470066 4:74755774-74755796 TAGCTCACACTTTCCAGTCCTGG + Intronic
982207338 4:153006446-153006468 CACCTCACACCCACCCTGCCCGG - Intergenic
985350695 4:189058370-189058392 TAGCTCACACCCAACCAATCAGG + Intergenic
985767403 5:1787255-1787277 CAGCTCACACTCACCTGCCCAGG - Intergenic
987738434 5:21874411-21874433 TAGCTCACACCCAACCAATCAGG + Intronic
988604611 5:32668713-32668735 CAGCTCACTCCCACCCGCCATGG + Intergenic
988956833 5:36328902-36328924 TAGCTCACACCCAACCAATCAGG - Intergenic
989669210 5:43894762-43894784 GTGCACACACCCACCCATCCTGG + Intergenic
989717665 5:44483229-44483251 TAGCTCACACCCAACCAATCAGG + Intergenic
995741384 5:115359290-115359312 TAGCTCACACCCAACCAATCAGG - Intergenic
995814618 5:116153427-116153449 TAGATCAGCCCCACCCATCCAGG - Intronic
999888071 5:155945893-155945915 TCCCTCACATCCACCCTTCCAGG - Intronic
1008581854 6:52914884-52914906 TAGCTCACACCCAACCAATCAGG - Intergenic
1011240165 6:85263702-85263724 TAGCTCACAATCACTCTTCCTGG - Intergenic
1014360226 6:120466180-120466202 TAGCCCTCACCCACCTGCCCAGG - Intergenic
1017754573 6:157518569-157518591 TAGGTGACACCCAACCGCCCCGG + Intronic
1018400223 6:163414324-163414346 CAGCCCACACCCACCCGCCCCGG + Intronic
1018768445 6:166952314-166952336 AAGCTCACACACAGCCCTCCTGG + Intronic
1019499809 7:1359175-1359197 AAGCTCAAACCCACCTCTCCTGG + Intergenic
1020106146 7:5423248-5423270 CAGCCCACCCCCACCCCTCCCGG + Intronic
1024010085 7:45259709-45259731 TGGTTCACACCCACCCTTCCAGG + Intergenic
1024984329 7:55182349-55182371 GAGCAGACACCCACCCGGCCTGG + Intronic
1027678001 7:81182617-81182639 TAGCTCACACCCAACCAATCAGG - Intronic
1029679789 7:102100417-102100439 AAGCTCACACCAACCCTACCTGG - Intronic
1031250912 7:119379232-119379254 TAGCTCACACCCAACCAATCAGG - Intergenic
1032077151 7:128841373-128841395 CAGCTCACACACACCTGCCCCGG + Intronic
1034013754 7:147559250-147559272 TACCTCACACTCACCCTTTCTGG - Intronic
1039236082 8:35504039-35504061 TACCTCTCACCCACCCTTCCAGG - Intronic
1039751076 8:40479250-40479272 TAGATCCCATCCACCCATCCAGG - Intergenic
1039856126 8:41415952-41415974 TAGATCACAGCCACCCGTCTAGG + Intergenic
1039891454 8:41688450-41688472 GAGCTCACGCCCACCCTTCTTGG + Intronic
1041378627 8:57227917-57227939 TATCTCACACCCCCTCATCCAGG - Intergenic
1045343353 8:101273388-101273410 TAGCTCACACCCCACCAACCAGG + Intergenic
1059034420 9:110738675-110738697 TACCTCCCACCCACCCCTTCTGG - Intronic
1062292471 9:135803032-135803054 CACATCACACCCACCAGTCCAGG + Intergenic
1062600056 9:137315522-137315544 TGGCTCACCCCCAGCCCTCCTGG - Intronic
1190195647 X:48315880-48315902 TGGCTCACACCTCCCCATCCAGG - Intergenic
1190427909 X:50349790-50349812 TAGCTCACACCCCCACTTCCAGG + Intronic
1190662098 X:52664092-52664114 TGGCTCACACCTCCCCATCCAGG - Intronic
1191071143 X:56401315-56401337 TAGCTCACACCCACGTTTCATGG + Intergenic
1191675263 X:63785938-63785960 TATCTCACACACACCACTCCAGG + Intergenic
1195535438 X:106003896-106003918 TAGCTCACACCCAACCAATCAGG + Intergenic