ID: 948641472

View in Genome Browser
Species Human (GRCh38)
Location 2:239378352-239378374
Sequence ATGATGGCCTGGAAGAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 1, 3: 52, 4: 408}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948641463_948641472 15 Left 948641463 2:239378314-239378336 CCAGGATGGAGACGGAGTTGGCA 0: 1
1: 0
2: 1
3: 7
4: 154
Right 948641472 2:239378352-239378374 ATGATGGCCTGGAAGAGGGAAGG 0: 1
1: 0
2: 1
3: 52
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948641472 Original CRISPR ATGATGGCCTGGAAGAGGGA AGG Intronic
900096949 1:943683-943705 CTGAAGACCTGGAAGGGGGAGGG - Exonic
900641898 1:3691545-3691567 CTGCTGGCTTGGAAGAGGGGAGG + Intronic
900755612 1:4432556-4432578 TGGATGGCCTGGCAGAGGCAGGG + Intergenic
901174662 1:7290197-7290219 GACATGGCCTGGCAGAGGGAAGG + Intronic
901391905 1:8951591-8951613 CTGAGGGCCCAGAAGAGGGAAGG + Intronic
901508275 1:9700432-9700454 ATGCTGGCCAGGAGGTGGGAAGG + Intronic
901628609 1:10637581-10637603 CTGGTGGCCTGGAGTAGGGAAGG + Exonic
902609199 1:17587445-17587467 CTGATCTCCTGGAAGAGAGAAGG - Exonic
902727988 1:18350091-18350113 ATGACAGCCTGGAGGAGCGAGGG - Intronic
903192901 1:21666725-21666747 ATGATGGCCTGGGTGTGGGTGGG + Intronic
904285404 1:29450383-29450405 ATTATGGCCTGGCAGAGTGATGG + Intergenic
904469524 1:30727853-30727875 ACAATGGCCTGGAAGGTGGAAGG - Intergenic
904625610 1:31800224-31800246 AGGGTGGACTGGAGGAGGGAGGG - Intronic
905993218 1:42358220-42358242 AGGATTGCCTGGAAGAGCCATGG - Intergenic
906170713 1:43722606-43722628 ATGGTGGCAGTGAAGAGGGAGGG + Intronic
906383717 1:45349125-45349147 AGGCTGGCAAGGAAGAGGGAGGG - Intronic
906715474 1:47965442-47965464 ATGAAGCCCAGGCAGAGGGAGGG + Intronic
908673297 1:66573033-66573055 ATGTTTGCCTGGAGGTGGGAGGG + Intronic
909350280 1:74644468-74644490 ATGGTGTCCTGGAAGCTGGAAGG - Intronic
909684793 1:78335719-78335741 AAGATGGCATTGAAGAAGGATGG - Intronic
910261105 1:85294626-85294648 TTGATGGACTGGAAGAGAGATGG - Intergenic
910615438 1:89192874-89192896 AGCATGGCCTGGATGTGGGAAGG - Intronic
912446625 1:109741197-109741219 AGGATGGACTGGAGGAGGAAAGG + Intronic
912451200 1:109768781-109768803 ATGATGGCATGGGGGTGGGAGGG + Intronic
912561288 1:110553392-110553414 ATGATGGTTGGGAAGAGGGAAGG + Intergenic
912748577 1:112266751-112266773 ATGATGTACAGGAATAGGGAAGG + Intergenic
913478898 1:119265708-119265730 TTGATGGCCTGGAAGATAAAAGG + Intergenic
915105862 1:153534889-153534911 AGGATTGCCTGGGAGGGGGAAGG - Intronic
915550864 1:156633243-156633265 ATGATGGCCTGGCAAGGGCATGG - Intergenic
916378242 1:164179761-164179783 TTGAGGATCTGGAAGAGGGAAGG - Intergenic
917136089 1:171789322-171789344 ATGATACCCTGGAGCAGGGAAGG + Intronic
917718018 1:177757618-177757640 ATGAAGGCAGGGAAGAGTGAAGG + Intergenic
919686273 1:200486583-200486605 GAGCTGGCCTGGAAGAGGCACGG - Intergenic
920086956 1:203424416-203424438 ATGCTGGCCTGGAAGACAGAAGG - Intergenic
920416016 1:205799823-205799845 ATGTTGGCCTGGGAAAGGGAGGG + Exonic
921031850 1:211341023-211341045 AGGATGGTCAGGAAGGGGGAAGG + Intronic
921493437 1:215807129-215807151 TTGCTGGCCTGGAAAATGGAAGG + Intronic
921787232 1:219245160-219245182 AGGAAGGGATGGAAGAGGGAGGG - Intergenic
921925446 1:220706900-220706922 ATGTTTGGCTGGGAGAGGGAAGG + Intergenic
923209797 1:231793274-231793296 ATGATGACCTGCAAAAGGAAAGG - Intronic
924147997 1:241097210-241097232 AGAATGGCCTGTAAGTGGGACGG + Intronic
924727182 1:246681893-246681915 ATGGAGGCCTGGGAGAGGGCAGG + Intergenic
1063087408 10:2832217-2832239 ATGAGAGGCTGGAAGAGGCAAGG - Intergenic
1063462635 10:6224227-6224249 ATGATGGCCAGGATGAGGCTTGG - Intronic
1064676874 10:17769288-17769310 ATGATGGGCTGGAACAAGTATGG + Intronic
1064997439 10:21308838-21308860 GTGATTGCCTGGGAGAAGGAAGG + Intergenic
1070522308 10:77264796-77264818 CTGATGGAGTGGATGAGGGATGG - Intronic
1072195832 10:93116561-93116583 ATAATGGCCTGGTCCAGGGATGG - Intergenic
1072486946 10:95864797-95864819 ATGATAGCCTTGCAGAAGGAGGG - Exonic
1073186779 10:101619779-101619801 AGGCTGGGCTGGAACAGGGATGG - Intronic
1074579890 10:114708931-114708953 ATGCTGACCTGGAAGAGGGGAGG - Intergenic
1075299330 10:121307396-121307418 AGGATGGAGTGGAAAAGGGAAGG - Intergenic
1075485771 10:122820935-122820957 ATGACGGCTTGGAAGAGGTGAGG - Intergenic
1076253188 10:128999111-128999133 GTGAAGGGCTGGAGGAGGGAAGG + Intergenic
1076667745 10:132102663-132102685 AAGATGGCCTCACAGAGGGAGGG - Intergenic
1077134460 11:991638-991660 ATGATGCCCTGGAAGTGTCACGG + Intronic
1077337506 11:2012013-2012035 CTGCTGGTCTGGCAGAGGGAGGG + Intergenic
1077910796 11:6570140-6570162 AGGAGAGCCTGGAAGAGGGTGGG + Intronic
1080180903 11:29424952-29424974 ATGATGATATGGAAGAGAGAGGG - Intergenic
1081312586 11:41592129-41592151 ATGAGGAGCTGGAAGGGGGATGG + Intergenic
1082830260 11:57611813-57611835 ATGATGGCCTTGAAAACAGAAGG - Exonic
1083208606 11:61168541-61168563 ATAGTGGTTTGGAAGAGGGAGGG - Intergenic
1083209867 11:61176536-61176558 ATCAGGGCCTGGAAGTGGAAAGG - Intergenic
1083266877 11:61550928-61550950 AGGATGACCTGGAAGTGGGGAGG - Intronic
1083381634 11:62274067-62274089 ATGAGCGCCTGGAAGCAGGAGGG + Intergenic
1083597092 11:63923125-63923147 AGGTTGGCCTTGAAGGGGGAAGG - Intergenic
1083983171 11:66191189-66191211 CTGATGGCCTTGAAGATGGAGGG - Intronic
1084089343 11:66870059-66870081 AGGATGGCTGAGAAGAGGGAGGG - Intronic
1084553734 11:69863999-69864021 GTGAGGGCCTGGAAGCCGGAGGG - Intergenic
1084570552 11:69957093-69957115 ATGCTGGGCTGGATGAAGGAAGG - Intergenic
1085583829 11:77681437-77681459 AGGGTGGCAGGGAAGAGGGAAGG - Intronic
1085868191 11:80319621-80319643 ATGTTTTCCTGGAAGAGAGATGG - Intergenic
1086804015 11:91217056-91217078 ATGAGGGCGGGGCAGAGGGATGG + Intergenic
1087054500 11:93920449-93920471 ATGATGGCCTGGAACATACAGGG - Intergenic
1087308382 11:96510430-96510452 ATTATGGCCTGGAAGCAGAATGG + Intergenic
1087733021 11:101799814-101799836 ATAATGGCCAGGAGGAGAGACGG + Intronic
1089026743 11:115278765-115278787 ATGCTGGCCTGAACCAGGGAGGG + Intronic
1089779150 11:120860942-120860964 AAGGGGGCCTGGGAGAGGGATGG - Intronic
1090653505 11:128825579-128825601 CTGATGGAGTGGGAGAGGGATGG + Intergenic
1090803808 11:130190276-130190298 AGAAGGGCCTGGAAGAGGAAGGG - Intronic
1090918988 11:131191857-131191879 ATGATGGCAGGGAGGTGGGACGG - Intergenic
1091112177 11:132979760-132979782 TTGAGGCCCTGGGAGAGGGAGGG + Intronic
1202820490 11_KI270721v1_random:67195-67217 CTGCTGGTCTGGCAGAGGGAGGG + Intergenic
1091450950 12:571514-571536 AGGAGGGCGCGGAAGAGGGAGGG - Intronic
1092228766 12:6765814-6765836 TGGATGGCCTTGAGGAGGGATGG - Intronic
1092238242 12:6822723-6822745 AGGAGGGACTGGAGGAGGGAGGG - Intronic
1092778846 12:11966813-11966835 CTGCTGGTCTGGAAGAGGGTAGG - Intergenic
1093500951 12:19811386-19811408 ATGATGGCCAGCAGGAGGCATGG - Intergenic
1093989536 12:25574350-25574372 ATAAAGGCCTGGATGGGGGAGGG - Intronic
1095287304 12:40429578-40429600 ATTATGCCCTGGAAGATGTAAGG + Exonic
1095850486 12:46798431-46798453 AGGATGGAGTGGAGGAGGGAGGG - Intronic
1096403548 12:51326293-51326315 GTGATGCCCTGGAAGAGGCAGGG + Intergenic
1096474348 12:51899076-51899098 ATGATGGCATGGAGGTGGGTGGG - Intergenic
1096817081 12:54208548-54208570 AGGATGGCTGGGAAGAGGGAGGG + Intergenic
1096829424 12:54302592-54302614 ATGATCTACTGGAAAAGGGATGG - Intronic
1097057304 12:56257889-56257911 AAGATGGCCTGGACCAGGGGCGG + Exonic
1097244171 12:57597281-57597303 ATGAAGGCCTGGGGGAGCGATGG + Intronic
1099144065 12:79016704-79016726 ATGATGTCATGGAGGAGGCATGG + Intronic
1099723444 12:86394136-86394158 AGGATGGCAGAGAAGAGGGAAGG + Intronic
1100323047 12:93515281-93515303 ATAATGGCCTGGATTAAGGAAGG + Exonic
1101353896 12:103958449-103958471 ATGAGGCCATGGAGGAGGGAGGG - Intronic
1101734624 12:107453779-107453801 ATGGTGGCCTGGAAGGGCAAGGG + Intronic
1101823119 12:108199322-108199344 ATCATGGCCCGGGAGTGGGAGGG + Intronic
1102576724 12:113860391-113860413 ATGCTGGCTTTGAACAGGGAGGG + Intronic
1102891504 12:116561968-116561990 ATGAGGGGGTGGAAGAGAGATGG - Intergenic
1103072622 12:117957437-117957459 ATGGTGGCCAGGAAGGAGGATGG - Intronic
1104029877 12:125057372-125057394 CGGATGGTCTGGAAGAGGAATGG - Intergenic
1106486795 13:30179557-30179579 AGAAAGGCTTGGAAGAGGGAGGG - Intergenic
1108682153 13:52789889-52789911 ATAATGGCCTGGGACATGGATGG - Intergenic
1112494287 13:99893416-99893438 AGGATGGCTTGGCAGTGGGAAGG + Exonic
1112506378 13:99978735-99978757 CTGATGGCCTGAAAGAAGGAAGG + Intergenic
1112698263 13:101974977-101974999 ATGAGGGGCTGGGAGAGGCAGGG + Intronic
1112744745 13:102514119-102514141 TTGATCACCTGGCAGAGGGAGGG - Intergenic
1113803520 13:113098980-113099002 ATGCTGGCCTGGAAGAGCATCGG + Intronic
1114345689 14:21792292-21792314 ATGTCTCCCTGGAAGAGGGAGGG + Intergenic
1115172232 14:30522537-30522559 ATGAAGGCCTTCAAGAGAGAAGG - Intergenic
1117758974 14:59006188-59006210 ATGATAGCCTAGGAGAGGAAAGG + Intergenic
1118000842 14:61522218-61522240 ATGGTGGCCTGGTATAGGGAGGG - Intronic
1118822153 14:69352618-69352640 CTGAAGGCTGGGAAGAGGGAAGG + Intronic
1119611341 14:76065477-76065499 AGGATGGGCTGGAAGGGGCACGG - Intronic
1120517544 14:85488724-85488746 ACGATGACAAGGAAGAGGGAGGG - Intergenic
1120576700 14:86189912-86189934 ATGATGAGGTGGAGGAGGGATGG + Intergenic
1121116988 14:91350802-91350824 ATGGTGGTCTGTAGGAGGGAAGG - Intronic
1121891315 14:97593863-97593885 ATCATGGGCTGGAATAGGGGAGG - Intergenic
1122378479 14:101285320-101285342 GTGATGCCGAGGAAGAGGGAGGG - Intergenic
1122600340 14:102918171-102918193 AGGATGGCCTGGAGGGTGGAAGG + Intergenic
1122626875 14:103089466-103089488 ATGATGGGGTGGCAGAGGGAAGG - Intergenic
1123031318 14:105452925-105452947 AGGATGACCTGGAAACGGGAGGG + Intronic
1123045747 14:105513059-105513081 TTGACGGCCTGGGAGAGGGATGG + Intergenic
1123438038 15:20270047-20270069 TTGATGGAGTTGAAGAGGGAAGG + Intergenic
1123984164 15:25630312-25630334 ATGCTGCCCAGGAGGAGGGATGG - Intergenic
1125532727 15:40424120-40424142 GGCATGGCCTGGAAGAAGGAAGG - Intronic
1127387069 15:58475259-58475281 ATTATGGTGTGGAAGATGGAGGG - Intronic
1127469193 15:59275442-59275464 ATAATTGCCTGGCAGAGGGAGGG - Intronic
1127815064 15:62600771-62600793 ATAATGGGTGGGAAGAGGGAAGG - Intronic
1127849310 15:62899066-62899088 AGGCCGGCCTGGAAGAGGGAGGG + Intergenic
1128304751 15:66590876-66590898 TTGCTGGCCTTGAAGATGGAGGG - Intronic
1128552906 15:68609684-68609706 AGGATGTCCTGGAAGAAGAATGG - Intronic
1129243795 15:74267846-74267868 GTGCTGGCCCGGAGGAGGGATGG - Intronic
1130668490 15:85890034-85890056 ATTATAGCCTGGAAGACAGACGG - Intergenic
1131057584 15:89384725-89384747 ATGATCTTCTGGAGGAGGGAAGG + Intergenic
1132331341 15:101014301-101014323 ATGAGGGCCTGAGAGAGAGAGGG - Exonic
1133246489 16:4452327-4452349 CTGATGGGCGGGAGGAGGGAAGG - Intronic
1133565240 16:6987052-6987074 ATGATGCCCAGGAAGAGGGCAGG - Intronic
1133712971 16:8419400-8419422 ATCTTGGAATGGAAGAGGGAAGG - Intergenic
1135752854 16:25070762-25070784 CTGATGGCCTGGAATTGGGCTGG + Intergenic
1136846540 16:33580805-33580827 TTGATGGAGTTGAAGAGGGAAGG - Intergenic
1137044504 16:35642999-35643021 AAGATGGCATGGGAGTGGGAGGG + Intergenic
1137272134 16:46908769-46908791 AAGAGGTCCTGGAGGAGGGAAGG + Intronic
1137711771 16:50571705-50571727 ATGATGGCTTAGAAGAGGATGGG - Intronic
1138801947 16:60043504-60043526 ATTATTGAGTGGAAGAGGGAAGG + Intergenic
1138888741 16:61114871-61114893 TTGCTGGCCTTGAAGATGGAAGG + Intergenic
1139387827 16:66585619-66585641 ATGAGGGACAGGAAAAGGGAAGG + Intronic
1140922503 16:79552093-79552115 ATGACTGCTTGGAAGAGGGCAGG - Intergenic
1140986891 16:80166376-80166398 ATGCTGGCTTTGAAGATGGAGGG + Intergenic
1140997206 16:80272564-80272586 AAGATTGCCTGGAAGAAGGAAGG + Intergenic
1141423443 16:83931422-83931444 AGGAGGGCCTGGAGCAGGGAGGG + Intronic
1141641873 16:85346328-85346350 ATGATGGGCAGGTAGATGGATGG + Intergenic
1141862514 16:86727660-86727682 ATGTTGGCCTGGCAGAGGTGGGG + Intergenic
1142256967 16:89018738-89018760 AGGATGGGCTGGAATAGGGAGGG - Intergenic
1142338624 16:89506813-89506835 ATGAAGGGCAGGGAGAGGGAGGG + Intronic
1203108248 16_KI270728v1_random:1429459-1429481 TTGATGGAGTTGAAGAGGGAAGG - Intergenic
1142645649 17:1312470-1312492 ACACAGGCCTGGAAGAGGGAGGG + Intergenic
1143711512 17:8739193-8739215 CTGGTGGCCTGGATGAGGAAGGG + Intronic
1143852718 17:9824793-9824815 ATGTTTGACTTGAAGAGGGAAGG + Intronic
1145415329 17:22709930-22709952 ATGAGGGGATGGAAGATGGAGGG + Intergenic
1146375260 17:32289463-32289485 AAGGTGTCCTGGGAGAGGGAAGG - Intronic
1146399247 17:32490305-32490327 CTGGTGGCATGGAAGAGGGAGGG + Exonic
1146821170 17:35984524-35984546 CTGAGGGCATGGAGGAGGGAAGG + Intronic
1147884557 17:43675992-43676014 AGGATGGGCTGGAGGAGGGACGG + Intergenic
1147919179 17:43906054-43906076 ATCAAGGCCTGGGAGGGGGAGGG - Intronic
1148463211 17:47849973-47849995 CTGATAGCCTGGGAGAGGGAGGG + Intronic
1148555659 17:48577332-48577354 ATGAGGGGGTGGAAGAGGGAGGG + Intronic
1149068989 17:52517449-52517471 TTGCTGGCTTTGAAGAGGGAGGG + Intergenic
1152048383 17:77953861-77953883 CAGATGACCTGGAAGAGGAAGGG - Intergenic
1152106034 17:78329658-78329680 GTGATGGCCTGTAAGAGAGGAGG + Intergenic
1152327820 17:79651765-79651787 AGGATGGACAGGGAGAGGGAGGG - Intergenic
1154452322 18:14487818-14487840 ATGAAGGCCTGTAAGGTGGAGGG - Intergenic
1155246924 18:23919671-23919693 AAGAAGGCCTGGAGGTGGGAAGG + Intronic
1155889976 18:31255599-31255621 ATGGAGTCCTGGAAGAGGGAAGG - Intergenic
1156242323 18:35266447-35266469 ATAAGGGCTTGGAAGAGAGAGGG + Intronic
1157394547 18:47330870-47330892 ATCTAGGCTTGGAAGAGGGAAGG - Intergenic
1157589720 18:48829062-48829084 CTGAAGGCTTGGAGGAGGGAGGG + Intronic
1157922554 18:51728218-51728240 CTGCTGGTCTGGAAGAGAGAAGG + Intergenic
1158116608 18:54003322-54003344 ATAATGGCTTTGAAGAGGGAGGG + Intergenic
1159380407 18:67650127-67650149 ATGATGGCTTGGGTGAGGGTCGG + Intergenic
1159903733 18:74072001-74072023 ATGTTGGGATGGAGGAGGGAAGG - Intergenic
1159919665 18:74216105-74216127 ATGATGTTCTGGCAGAGGGAAGG - Intergenic
1161580991 19:5081033-5081055 GGGATGGCCTGGTAGAGGGCTGG + Intronic
1162493359 19:11008459-11008481 AGGATGACCTCCAAGAGGGAAGG - Intronic
1164810374 19:31150323-31150345 CTGATGGCCTGCAAGGGGGATGG + Intergenic
1165034011 19:33019948-33019970 CTGATGGAGTTGAAGAGGGAAGG + Intronic
1165038250 19:33050008-33050030 ATGATGGCCTGGTGGGGGGCAGG + Intronic
1165325279 19:35111156-35111178 ATCATGGCCTTGAAGGTGGAAGG + Intergenic
1165380004 19:35472521-35472543 AAACTGGCCTGGAAGAGAGACGG - Intergenic
1165427246 19:35752964-35752986 ATGATGGGCTGGCTGAGGGAGGG + Exonic
1165588563 19:36944663-36944685 ATGATGGGGAGAAAGAGGGATGG - Intronic
1166909800 19:46145391-46145413 GTGTTGGACTGGACGAGGGAGGG - Intronic
1167567794 19:50267779-50267801 AGGATGGACTGGAAGGGGAAAGG + Intronic
1167623008 19:50569088-50569110 ATGAGAGGATGGAAGAGGGAGGG + Intergenic
1167663459 19:50810212-50810234 AGGATGGGTTGGAACAGGGATGG + Intergenic
1168115821 19:54220992-54221014 GTGATGGCCGGGATGAGGGGTGG - Intronic
1168118801 19:54240740-54240762 GTGATGGCCGGGATGAGGGGTGG - Intronic
1168133747 19:54337307-54337329 GTGATGGCCGGGATGAGGGGTGG - Intronic
1168176848 19:54632829-54632851 GTGATGGCCGGGATGAGGGATGG + Intronic
1168185667 19:54698014-54698036 GTGATGGCCGGGATGAGGGGTGG + Intronic
1168187639 19:54709920-54709942 GTGATGGCCGGGATGAGGGGTGG + Intergenic
1168309590 19:55453689-55453711 CTGAGGGCCCAGAAGAGGGATGG - Intronic
925908088 2:8551504-8551526 ATGAAGGCTTAGAAGTGGGAAGG - Intergenic
926188907 2:10712587-10712609 AGGAGGGACAGGAAGAGGGACGG + Intergenic
926774400 2:16407595-16407617 ATGATGTCATGGAAAAGGCACGG + Intergenic
927907500 2:26870778-26870800 TTGATGGACTGGCAGAGGCAGGG + Intronic
928212828 2:29336347-29336369 AAGATGCCCTGGAAGGGAGAAGG - Intronic
928398141 2:30958847-30958869 AAGATGGCCTGGGAGAGGCTGGG - Intronic
928934847 2:36665119-36665141 ATGAATGCCTGGAACAGAGAAGG + Intergenic
929163024 2:38852556-38852578 AGGAGGGCCAGGAAGATGGATGG - Intronic
929644853 2:43616097-43616119 CTGATGTCATGGAGGAGGGATGG + Intergenic
929686551 2:44040045-44040067 ATGATGGCCTGAACCAGTGATGG + Intergenic
929712982 2:44283113-44283135 AGGAGGGACTGGAGGAGGGAGGG - Intronic
930300428 2:49609031-49609053 ATGATCCCCAGGAAGAGGGGTGG - Intergenic
930336339 2:50052001-50052023 AAAATGTCCTAGAAGAGGGATGG - Intronic
930564190 2:52999082-52999104 ATGATGGCCTGTTAAGGGGATGG + Intergenic
931778347 2:65558885-65558907 ATGAAGTCCTGTATGAGGGAGGG - Intergenic
931939987 2:67241493-67241515 ATGATGGCAGGAAGGAGGGAAGG + Intergenic
934607196 2:95705260-95705282 AGGATGGCCTGGGACAGGCAAGG - Intergenic
934971956 2:98770941-98770963 GTGATGACCGGGAAGATGGACGG - Intergenic
935099039 2:99974885-99974907 ATGATGGTCTGGGAAAGGTATGG + Intronic
935639239 2:105275072-105275094 TTGTGGGCCTGGAGGAGGGAGGG - Intronic
935874999 2:107496886-107496908 ATGAAGGCTTGGGGGAGGGATGG - Intergenic
936540593 2:113347417-113347439 AGGATGGCCTGGAACAGGCAAGG - Intergenic
936944144 2:117915340-117915362 ATGTTGGGCTGGCAGAGGGAGGG - Intergenic
937145587 2:119641448-119641470 ACAATGGCATGGAAGAGAGAAGG + Intronic
937911212 2:127076438-127076460 ATGCTGGGAAGGAAGAGGGATGG - Intronic
938314718 2:130317716-130317738 AGGAAGGCAGGGAAGAGGGAAGG - Intergenic
939248866 2:139661124-139661146 ATGGTGGCTGGGAGGAGGGAAGG + Intergenic
939575406 2:143889059-143889081 ATTCTTGCCTTGAAGAGGGATGG - Intergenic
941139483 2:161761346-161761368 ATGAAGGCCTGCAAGACAGATGG + Intronic
942161134 2:173188717-173188739 ATGATAACCTAGAAGAGGAAAGG - Intronic
942475485 2:176315444-176315466 ATGGTGGCCTGGACCAGGGTGGG - Intronic
943521016 2:188949399-188949421 ATGAGGAGCTGGAAGTGGGAAGG - Intergenic
945735440 2:213593650-213593672 ATGATGACCTAGAAAAGAGAAGG - Intronic
946327467 2:218992295-218992317 ATCATGGCCGGCAAGGGGGAGGG - Intronic
946539783 2:220671373-220671395 ATGTTGGCCAGGAGGAGGGTGGG + Intergenic
946860995 2:224000273-224000295 CTGGTGGCCAGGAAGAGGGGGGG + Intronic
947087147 2:226466151-226466173 ATGATTGCCTGGCAGCAGGAAGG - Intergenic
948258663 2:236586745-236586767 ATGGTGGCCGGCAAGAGAGAAGG - Intergenic
948491059 2:238313715-238313737 CTGAGGGCCTGTGAGAGGGAGGG + Intergenic
948525763 2:238569973-238569995 AAGAGGACCTGGAAGAGGGCGGG + Intergenic
948534743 2:238637513-238637535 CTGCTGGCCTGGAAGAAGGAAGG + Intergenic
948641472 2:239378352-239378374 ATGATGGCCTGGAAGAGGGAAGG + Intronic
1168889457 20:1284981-1285003 ATGGTGGCTTGGACCAGGGATGG + Intronic
1169025904 20:2371239-2371261 ATAATGGTGGGGAAGAGGGAAGG - Intergenic
1169117096 20:3072685-3072707 TGGAGGGGCTGGAAGAGGGAGGG + Intergenic
1169475789 20:5930123-5930145 AGGAAGGCCTGGAAGAAGCAAGG - Intergenic
1170526841 20:17247216-17247238 ATGATGCCCAGGAGTAGGGATGG - Intronic
1171004875 20:21454524-21454546 AGGATGGGCTAGCAGAGGGAGGG + Intergenic
1171168672 20:22995884-22995906 AGGATGGCCAAGCAGAGGGAGGG - Intergenic
1172613625 20:36268925-36268947 ATGGAGGCCTGGAGGAAGGAAGG + Intronic
1172884540 20:38222411-38222433 AGGATGGGGTGGAAGAGGAAAGG + Intronic
1172893464 20:38283462-38283484 ATGGTGGCCTGGATGGTGGACGG + Intronic
1174098189 20:48106265-48106287 CTGAGGCCCTGGAAGAGGCAAGG - Intergenic
1174574354 20:51526129-51526151 AAGATGGCAGGGAAAAGGGAAGG - Intronic
1175227608 20:57453919-57453941 CTGCTGGCCTGGAAGAGGGCAGG - Intergenic
1175284840 20:57831055-57831077 ACACTGGGCTGGAAGAGGGAGGG + Intergenic
1175772988 20:61635448-61635470 AAGAGGGGCTGGCAGAGGGAGGG + Intronic
1175822052 20:61915333-61915355 AGGATGCCCTGGAAGAGGACTGG - Intronic
1176064894 20:63189204-63189226 ATGATCGCCAGGAGGATGGATGG + Intergenic
1176230059 20:64027995-64028017 ATGATGGCTGGGACGAGGGAAGG + Intronic
1176443704 21:6800482-6800504 ATGAAGGCCTGTAAGGTGGAGGG + Intergenic
1176821871 21:13665521-13665543 ATGAAGGCCTGTAAGGTGGAGGG + Intergenic
1176889192 21:14293835-14293857 ATGATGGTCTTCAAGAGAGACGG + Intergenic
1177024932 21:15911378-15911400 ATGGAGGGCTGGGAGAGGGATGG - Intergenic
1177121603 21:17143721-17143743 ATGGTGGACTGAAACAGGGATGG + Intergenic
1177880429 21:26687961-26687983 ATTTTTGCCTGGAGGAGGGAGGG + Intergenic
1179470941 21:41609922-41609944 AAGATGGCCTGGAAGGGAGGGGG + Intergenic
1179717641 21:43298005-43298027 ATGAAGGCCTGGGAGGGGGCTGG + Intergenic
1180059201 21:45375941-45375963 ATGATGGCCTGGAGGTGGCCTGG + Intergenic
1180059208 21:45375966-45375988 ATGATGGCCTGGAGGTGGCCTGG + Intergenic
1180059215 21:45375991-45376013 ATGATGGCCTGGAGGTGGCCTGG + Intergenic
1180059229 21:45376038-45376060 ATGATGGCCTGGAGGTGGCCTGG + Intergenic
1180059235 21:45376063-45376085 ATGATGGCCTGGAAGTGGCCTGG + Intergenic
1180059246 21:45376099-45376121 ATGATGGCCTGGAGGTGGCCTGG + Intergenic
1180059253 21:45376124-45376146 ATGATGGCCTGGAGGTGGCCTGG + Intergenic
1180083349 21:45496732-45496754 GTGAAGGCCTGGGAAAGGGAGGG + Intronic
1181102444 22:20550496-20550518 AAGATGGCAGGGCAGAGGGAAGG - Intronic
1181115961 22:20632679-20632701 ATGGTGGCCTGGAAGGCAGAGGG + Intergenic
1181556633 22:23675189-23675211 ATGATGGAATGAAAGAAGGAAGG - Intergenic
1181675520 22:24449067-24449089 TTGCTGGCCTGGAAGAGGCCTGG + Intergenic
1181865118 22:25848578-25848600 ATGATGGGCTGGCAGGGGGATGG + Intronic
1182089972 22:27587811-27587833 GTGAAGGCCTGGAAGTGGGATGG - Intergenic
1182298848 22:29327008-29327030 GTGATGCCCTGCAAGAGGGCAGG + Intergenic
1183211204 22:36452489-36452511 ATCAGGGTCTGGCAGAGGGAGGG + Intergenic
1183324818 22:37185448-37185470 ATGGTGACCTGGAACAAGGAAGG + Exonic
1183338811 22:37266891-37266913 GAGCTGGCTTGGAAGAGGGAAGG - Intergenic
1184414586 22:44344880-44344902 CTGTTGGCCTGGGGGAGGGAGGG - Intergenic
1184513721 22:44947486-44947508 TGAATGGCCTGGCAGAGGGAAGG + Intronic
1184868886 22:47220374-47220396 ATGAAGGCCTGGAGGGGGCAGGG - Intergenic
1185005916 22:48276996-48277018 AGGATGGGCTGGAGGAGGCAGGG - Intergenic
949307871 3:2663298-2663320 TTGATGGCATAGAATAGGGATGG + Intronic
950526876 3:13529391-13529413 ATGATGGGTTGAAAGAAGGAAGG - Intergenic
951886628 3:27531159-27531181 AGGTTGGCCTGGCAGAGGGAGGG - Intergenic
952513138 3:34076941-34076963 ATGGTGGCCTGGACTAGGGATGG + Intergenic
954002682 3:47570240-47570262 AAGATAATCTGGAAGAGGGAAGG - Intronic
954320457 3:49829125-49829147 AGCTTGGCCTGGAAGAGAGAAGG + Exonic
954673056 3:52300935-52300957 ATGAAGGCCTGGGACAGGCAAGG + Intergenic
955031302 3:55222554-55222576 ATCATGGCAGGGAAGAAGGAAGG + Intergenic
955098586 3:55824337-55824359 ATGGGGGCCTGGATGATGGAAGG - Intronic
956269586 3:67436406-67436428 ATAATAGACTGGAGGAGGGAGGG + Intronic
956888500 3:73585648-73585670 ATTATTTCCTGGAAGATGGATGG + Intronic
957652549 3:83027051-83027073 ATGCAGGCTTGGAAGATGGAAGG + Intergenic
958451842 3:94282680-94282702 AGGATGCCCTGAAAGAGGAAGGG - Intergenic
959105831 3:102063539-102063561 ATGGAGGCAAGGAAGAGGGAAGG - Intergenic
959564829 3:107823834-107823856 ATCACGGCGTGGAGGAGGGAGGG - Intergenic
960038362 3:113124352-113124374 CTGCTGGGCTGGGAGAGGGAGGG + Intergenic
960231288 3:115230325-115230347 ATGGTGGGCTGGGAGAGGGAAGG + Intergenic
961325887 3:126109141-126109163 TTGATGGCATGAAGGAGGGAAGG - Intronic
961326406 3:126111890-126111912 ATCATGGCCTGGATGAAGGATGG + Intronic
961415701 3:126755047-126755069 ACGATGGCCTGGAAAAGAGGAGG + Intronic
962383106 3:134912662-134912684 CTGATGGCCTGGGAGTGGGTGGG + Intronic
962509192 3:136081768-136081790 ATGGTGGCCTGGCATAGGCATGG - Intronic
964817321 3:160730864-160730886 CTGCTGGCTTTGAAGAGGGAAGG - Intergenic
965501156 3:169457745-169457767 GTGAGGGCCTGGAAGACTGATGG - Intronic
965961232 3:174430773-174430795 ATGATGGCTAGGGAGTGGGAAGG - Intergenic
966475378 3:180338893-180338915 AGGATGGATTGGAAGAGGGCAGG - Intergenic
968360829 3:198145532-198145554 AGCCTGTCCTGGAAGAGGGATGG - Intergenic
969337395 4:6519733-6519755 AGTATTGCCTGGAAGAGGGCAGG - Intronic
969543348 4:7807868-7807890 ATGGTGGTCAGGAGGAGGGATGG - Intronic
969875235 4:10131375-10131397 AGGGTGACCTGGAAGAGGGCAGG + Intergenic
970452602 4:16185793-16185815 ATGATGTCCTTGAGGAAGGAGGG - Intronic
970559623 4:17269801-17269823 ATGAGAGCCTGGCAGTGGGAGGG - Intergenic
972259726 4:37396114-37396136 ATGATGGCATGCAAGACGGCAGG - Intronic
972299222 4:37769408-37769430 ATGTTGGCTTTGAAGATGGATGG + Intergenic
972658330 4:41088585-41088607 ATGAGGCCCTGGAAGAGGGAGGG - Intronic
972980981 4:44700826-44700848 ATCAGAACCTGGAAGAGGGAGGG - Exonic
974373909 4:61051649-61051671 ATTATTGCCTAGAAGAGGCATGG - Intergenic
974637045 4:64578848-64578870 TTGATGGCTTTGAAGAGGGAGGG - Intergenic
975758884 4:77598408-77598430 TTCAGAGCCTGGAAGAGGGAAGG + Intronic
975935079 4:79569918-79569940 ATGATGGTGTGGAAGGAGGATGG + Intergenic
978887028 4:113776434-113776456 ATGATGGCATGTAAGTGGGAAGG - Intergenic
979117479 4:116844814-116844836 ATGAGTGAATGGAAGAGGGATGG + Intergenic
979251446 4:118570904-118570926 ATGTGCGCCTGAAAGAGGGAGGG + Intergenic
979300627 4:119082316-119082338 TTGATGGCCTGGAGGAAGGTCGG - Intergenic
979392256 4:120141143-120141165 ATGGAGAGCTGGAAGAGGGATGG - Intergenic
980027902 4:127788415-127788437 ATGTTGCCCTAGAAGGGGGAGGG - Intronic
981346862 4:143685867-143685889 GTGGGGGCCTGGAGGAGGGATGG + Intronic
981610690 4:146590723-146590745 ACCATGGCCTGGAAGTGGCAAGG + Intergenic
985288157 4:188358478-188358500 ATGATGGGGTGGAGCAGGGATGG - Intergenic
985302273 4:188503440-188503462 ATAAGGTCCTGGAAGAGAGAGGG + Intergenic
985302379 4:188504289-188504311 ATAAGGTCCTGGAAGAGAGAGGG + Intergenic
985302462 4:188505015-188505037 ATAAGGTCCTGGAAGAGAGAGGG + Intergenic
985302787 4:188507552-188507574 ATAAGGTCCTGGAAGAGAGAGGG + Intergenic
985302835 4:188507910-188507932 ATAAGGTCCTGGAAGAGAGAGGG + Intergenic
985302853 4:188508030-188508052 ATAAGGTCCTGGAAGAGAGAGGG + Intergenic
985303030 4:188509421-188509443 ATAAAGTCCTGGAAGAGAGAGGG + Intergenic
985519900 5:369279-369301 AGAATGCCCAGGAAGAGGGAGGG - Intronic
989417463 5:41196429-41196451 ATGATGTCCAGGGAGAAGGAGGG + Intronic
989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG + Intronic
990066369 5:51720510-51720532 ATGATGGCGAGGAAGAGGGCTGG - Intergenic
990356860 5:54976179-54976201 AAGATGGATGGGAAGAGGGATGG - Intergenic
993866820 5:93205675-93205697 ATGATGTCCTGAAACAGGGTAGG + Intergenic
995850015 5:116535099-116535121 AGGATGGCCTGAAGGAAGGAAGG + Intronic
996372238 5:122765839-122765861 ATGGTGGCCTGGAGGTGGTAAGG - Intergenic
996423099 5:123284023-123284045 GTGATGGCCTAGAAGATGTAGGG + Intergenic
997375298 5:133393491-133393513 GTGAAGGCCAGGAAGAGGGCTGG + Intronic
997674814 5:135705038-135705060 AAGATGACCTGGGACAGGGAGGG + Intergenic
998166373 5:139846687-139846709 ATGCTGGCCTGGAGGTTGGAGGG - Intergenic
998171505 5:139874534-139874556 ATGGTGGCCTGGACTAGGGGAGG - Intronic
999018153 5:148132200-148132222 ATGGTGGCCAGGAGAAGGGAAGG - Intronic
999183686 5:149689625-149689647 ATGATGGCTGGCTAGAGGGATGG + Intergenic
999523907 5:152381713-152381735 ATCATGGCCTGGAGGTGAGAGGG + Intergenic
999715371 5:154355953-154355975 TCTATGACCTGGAAGAGGGAGGG - Intronic
1001218332 5:169876539-169876561 CTGATGGCCTGGAAGAACAAGGG + Intronic
1002090588 5:176803195-176803217 ATGGGAGCCTGGAAGAGGGAGGG + Intergenic
1002921176 6:1574553-1574575 TTGACGGCCTGGAACAGGAACGG + Intergenic
1003016529 6:2472498-2472520 AGGATGGCCTGGAGATGGGAAGG - Intergenic
1003020543 6:2505260-2505282 CTGATGGCCTGGACTGGGGAAGG - Intergenic
1003055321 6:2812958-2812980 ATGATTGCCTGGACTGGGGAAGG - Intergenic
1003757862 6:9142350-9142372 ATGCTGGCTTGGAAGATGGAAGG - Intergenic
1004465504 6:15881418-15881440 ATGAGGAACTGGAAGAGGCATGG + Intergenic
1006374158 6:33662724-33662746 AGGATGGTGGGGAAGAGGGAGGG - Intronic
1006949235 6:37807963-37807985 AAGATGGCCTGTTATAGGGAGGG - Intergenic
1007326087 6:41061043-41061065 ATGTTGTGCTGGAAGAGTGATGG + Intronic
1008146992 6:47903916-47903938 AAGATGGCCTGAAAGAAGGGAGG + Intronic
1011223103 6:85078502-85078524 AGGAGGCCCTGGAAGAAGGAAGG - Intergenic
1012420203 6:99056495-99056517 AAGATGGTCTAGCAGAGGGATGG + Intergenic
1012909576 6:105104064-105104086 AGCTTGGACTGGAAGAGGGAGGG - Intronic
1016254530 6:142088498-142088520 ATGATGAGCAGGTAGAGGGACGG + Exonic
1016854702 6:148655577-148655599 ATGATGTCCTAGAAGAGTGAAGG - Intergenic
1017042344 6:150317574-150317596 ATCACTGCCTGGCAGAGGGAGGG + Intergenic
1017944233 6:159080602-159080624 AAGGTGGCCTGGCAGAGGAACGG + Intergenic
1018225554 6:161625417-161625439 ATGGGGGCCTGGGGGAGGGATGG + Intronic
1019259182 7:71122-71144 AGCCTGTCCTGGAAGAGGGATGG + Intergenic
1019318917 7:406037-406059 AGGGTGGTCTGGAGGAGGGAGGG - Intergenic
1019430640 7:997426-997448 AGGAGGGTCTGGAGGAGGGAAGG + Exonic
1019658542 7:2210824-2210846 CTGATGGCCAGGAAGGTGGATGG - Intronic
1021167813 7:17362017-17362039 ATGATGGCCTTGAAGATAAAGGG + Intergenic
1022471737 7:30685759-30685781 AGGATGGCCTGGGAGAAGTAAGG - Intronic
1024136435 7:46413350-46413372 ATGATGGCTATGAATAGGGAGGG + Intergenic
1027569555 7:79847237-79847259 ATGCAGAGCTGGAAGAGGGATGG - Intergenic
1028628700 7:92908345-92908367 ATGATGGAGTGGAAAAAGGATGG - Intergenic
1028669742 7:93387822-93387844 TTGCTGGCCTGGATGAGGGTGGG - Intergenic
1028982210 7:96979727-96979749 GTGTTGGCCTGGGAGAGGGGTGG - Intergenic
1029845909 7:103412049-103412071 AGGAAGGCAGGGAAGAGGGAAGG + Intronic
1031141590 7:117948923-117948945 GTGCTGGCCTGGAAGAGCAATGG + Intergenic
1032257701 7:130310610-130310632 GAGAAGGCATGGAAGAGGGAGGG - Intronic
1032493826 7:132345852-132345874 GTGCTGGCCTGGGAGAGGGGTGG - Intronic
1033012317 7:137635641-137635663 ATGAAGGCCTGACAGAGAGATGG + Intronic
1033458842 7:141527271-141527293 AAGATGGGGTTGAAGAGGGATGG - Intergenic
1033524230 7:142194459-142194481 ATGAAGGCCTGGAATAAGGCAGG - Intronic
1034352075 7:150422886-150422908 ATGATGGCTGAGAAGGGGGAGGG + Intergenic
1034646192 7:152649954-152649976 ATGGTGGCGTGGAAGACAGAAGG + Intronic
1034678838 7:152912262-152912284 AGGATGGCCTGGGAGGAGGAAGG - Intergenic
1035470111 7:159104320-159104342 GTGCTGGCCGGGAGGAGGGAGGG - Intronic
1035470139 7:159104437-159104459 GTGCTGGCCAGGAGGAGGGAGGG - Intronic
1035673074 8:1434862-1434884 ATGATACCATGGAGGAGGGAGGG - Intergenic
1036010697 8:4719141-4719163 ATGATGGCCTGGAGAAAGGCAGG + Intronic
1037522853 8:19697133-19697155 AGGATGGCCAGAAAGAGGCAAGG + Intronic
1038567438 8:28631680-28631702 ATGATGCCATGGAAAAGGCATGG + Intronic
1038911242 8:31967256-31967278 AAGAGGGCGTGGAGGAGGGAGGG - Intronic
1038919898 8:32071083-32071105 ATGATGGGCTGGTTGAGGTAAGG - Intronic
1039445519 8:37628633-37628655 ATGATTGCCTGGAAGATCAATGG - Intergenic
1039786603 8:40839796-40839818 ATGAAGTCTTGGAAGAGTGAGGG + Intronic
1039848340 8:41342077-41342099 AAGAGGGCCAGGAAGAGAGAGGG + Intergenic
1042057504 8:64781554-64781576 TTGCTGGCTTGGAAGATGGATGG - Intronic
1042508599 8:69588192-69588214 ATGCAGGTCTGTAAGAGGGAGGG - Intronic
1043040319 8:75254203-75254225 ATGGTGGCCAGCAAGAGAGAAGG + Intergenic
1045068709 8:98477736-98477758 ATGAAGGCAAGGGAGAGGGAAGG + Intronic
1046243174 8:111526131-111526153 AAGATGGCCTGGCACTGGGATGG + Intergenic
1046438441 8:114227016-114227038 ATAATGGCCTGGAATAAGGAAGG - Intergenic
1047494933 8:125402676-125402698 GGGATGGCCTGGAACAGTGAGGG + Intergenic
1049103901 8:140599195-140599217 ATGCTGGCCTGTCAGTGGGATGG - Intronic
1049315994 8:141968000-141968022 ATGTTGGGGTGGAAGTGGGAGGG + Intergenic
1049441430 8:142611559-142611581 AGGATGGCCTGGCAGCGGGCGGG + Exonic
1051244261 9:15093236-15093258 TTGCTGGCTTTGAAGAGGGAAGG - Intergenic
1054762496 9:69015588-69015610 ATGGTGGCCTGGGGGAGTGATGG - Intergenic
1054937111 9:70699799-70699821 ATAAGGGCCTGGAATAGGGGTGG + Intronic
1055420608 9:76137111-76137133 GTTATGGACTGGAACAGGGAAGG + Intronic
1056197685 9:84244524-84244546 AAGATGGACTAGAAGAGGGAAGG - Intergenic
1056748169 9:89323261-89323283 ATGGAGGCCTGGACTAGGGAAGG + Intronic
1056788860 9:89612449-89612471 TTGCTGGCTTTGAAGAGGGAGGG + Intergenic
1057724556 9:97558994-97559016 GTGATGGTCTAGAAAAGGGATGG - Intronic
1057902630 9:98961480-98961502 ATGATGGGCTGGAAGAGGAGTGG + Intronic
1059526385 9:114994513-114994535 AGGATGGGCTCGAAGAGGGTAGG - Intergenic
1059627367 9:116081371-116081393 GTGATGGCCTGGTAGAAGGGTGG - Intergenic
1060743974 9:126117785-126117807 AGGAGGGGCAGGAAGAGGGATGG + Intergenic
1060896774 9:127223932-127223954 ATGCTGGCCTGGAACTGGGATGG - Intergenic
1061652602 9:132063054-132063076 AAGATGGCCTGAAACAGGGTGGG + Intronic
1061993483 9:134172659-134172681 CTGAGGGCCTGAAAGAAGGAGGG + Intergenic
1062745534 9:138209363-138209385 AGCCTGTCCTGGAAGAGGGATGG - Intergenic
1203525495 Un_GL000213v1:84045-84067 ATGAAGGCCTGTAAGGTGGAGGG - Intergenic
1185613166 X:1404011-1404033 ATGATGGGCAGGTAGACGGATGG + Intronic
1186624264 X:11275613-11275635 ATGATGGCTTTCAAAAGGGAAGG - Intronic
1190333985 X:49251758-49251780 AGGATGGCCTGGAAGTTGGGGGG + Exonic
1191675250 X:63785823-63785845 ATGGAGGTTTGGAAGAGGGAAGG + Intergenic
1191677685 X:63808796-63808818 TTGATGGCTTTGAAGATGGAAGG + Intergenic
1191900705 X:66038319-66038341 ATGAGGTCCAGGGAGAGGGAAGG + Intronic
1195682694 X:107560758-107560780 TTGATGACCTGCAGGAGGGAGGG - Exonic
1195771651 X:108357835-108357857 ATGTTGTCCTAGAATAGGGATGG + Intronic
1196700621 X:118664003-118664025 ATGAAAGCAAGGAAGAGGGAAGG + Intronic
1196730769 X:118939029-118939051 ATGCTGCCCAGCAAGAGGGATGG - Intergenic
1198591744 X:138190696-138190718 ATGGTGGCCTGGTTGAGGGAGGG + Intergenic
1198697653 X:139359736-139359758 ATGAAGAGCTGGAAGGGGGACGG + Intergenic