ID: 948642647

View in Genome Browser
Species Human (GRCh38)
Location 2:239385363-239385385
Sequence AGTCCTCGGAGGTGACCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948642647_948642659 27 Left 948642647 2:239385363-239385385 CCTCCGGGTCACCTCCGAGGACT 0: 1
1: 0
2: 0
3: 6
4: 74
Right 948642659 2:239385413-239385435 CTCTGCCCAGCTCAGCAGCGGGG 0: 1
1: 0
2: 4
3: 34
4: 291
948642647_948642651 -10 Left 948642647 2:239385363-239385385 CCTCCGGGTCACCTCCGAGGACT 0: 1
1: 0
2: 0
3: 6
4: 74
Right 948642651 2:239385376-239385398 TCCGAGGACTGAAGAAAAGGAGG 0: 1
1: 0
2: 1
3: 18
4: 168
948642647_948642657 25 Left 948642647 2:239385363-239385385 CCTCCGGGTCACCTCCGAGGACT 0: 1
1: 0
2: 0
3: 6
4: 74
Right 948642657 2:239385411-239385433 GACTCTGCCCAGCTCAGCAGCGG 0: 1
1: 0
2: 0
3: 26
4: 272
948642647_948642658 26 Left 948642647 2:239385363-239385385 CCTCCGGGTCACCTCCGAGGACT 0: 1
1: 0
2: 0
3: 6
4: 74
Right 948642658 2:239385412-239385434 ACTCTGCCCAGCTCAGCAGCGGG 0: 1
1: 0
2: 2
3: 29
4: 377
948642647_948642653 -3 Left 948642647 2:239385363-239385385 CCTCCGGGTCACCTCCGAGGACT 0: 1
1: 0
2: 0
3: 6
4: 74
Right 948642653 2:239385383-239385405 ACTGAAGAAAAGGAGGCTCCTGG 0: 1
1: 1
2: 1
3: 41
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948642647 Original CRISPR AGTCCTCGGAGGTGACCCGG AGG (reversed) Intronic
901086375 1:6614297-6614319 GGTCCGCGGAGGGGACGCGGAGG - Intronic
901242400 1:7703287-7703309 GGTCCTGCGTGGTGACCCGGGGG + Intronic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
906525135 1:46489456-46489478 AGTCCGTAGAGGTGACCTGGGGG - Intergenic
914689184 1:150010513-150010535 ATTCCTCGGCAGTGACCCCGGGG + Exonic
916582989 1:166124945-166124967 ATTTCTCAGAGGTGACCTGGTGG - Intronic
919744576 1:201000446-201000468 ATGCCTCGGAGGTGATCCGCAGG - Exonic
1064408901 10:15088605-15088627 AGCGGTCGGCGGTGACCCGGGGG - Intronic
1075960990 10:126567608-126567630 AGCCCTGGAAGGTGACCTGGAGG + Intronic
1077546004 11:3170313-3170335 AGTCCTCAGAGGTGACTCCCAGG + Intergenic
1083274411 11:61588544-61588566 AGTCCTCGGAGCTCTCCTGGAGG + Intergenic
1083681092 11:64352215-64352237 AGTCCCAGGAGGAGACCCGCGGG + Exonic
1084196067 11:67524099-67524121 AGTCCAGGGAGGGGACCAGGAGG - Intergenic
1085424000 11:76386896-76386918 AGTCCTTGGAGGGGACCCACTGG - Intronic
1100603120 12:96129370-96129392 GGTCCTCTGAGGTGACCAAGAGG + Intergenic
1103167026 12:118778946-118778968 CGGCCTTGGAGGTGACCCAGAGG - Intergenic
1103951690 12:124554885-124554907 AGCCTTCGAGGGTGACCCGGAGG + Intronic
1122284463 14:100642436-100642458 ACTCCAGGGAGGTGACCCTGAGG + Intergenic
1202903366 14_GL000194v1_random:55541-55563 GGTCCTCGGAGGTGTCGCGAAGG + Intergenic
1124014716 15:25864839-25864861 AGGCCTCGGGGGTCACCAGGTGG - Intronic
1128897492 15:71388875-71388897 TGTTGTAGGAGGTGACCCGGTGG + Intronic
1129666421 15:77582009-77582031 AGTCCTGAGGGGTGTCCCGGGGG - Intergenic
1131200578 15:90392476-90392498 ATTCCACTGAGGTGACCTGGGGG + Intronic
1131602327 15:93862182-93862204 AGTCAAAGGAGGTGACCCAGAGG + Intergenic
1133636261 16:7668574-7668596 ACTCATCGGAGGTGATGCGGGGG + Intronic
1142619150 17:1154095-1154117 AGTCCTCGGAGCAGAACTGGGGG - Intronic
1147583374 17:41638930-41638952 AGGCCTCGGGGGTCACCCGTGGG + Intergenic
1147998788 17:44375763-44375785 AGCCCACAGAGGTGCCCCGGTGG + Intronic
1151940533 17:77288812-77288834 ATTGCTGGGAGGTGAGCCGGTGG + Intronic
1155199429 18:23503894-23503916 TGTCCTCGCAGGTGACCTCGGGG + Intronic
1161998938 19:7731119-7731141 AGTCCTCCCAAGTGACCCGAGGG - Intronic
1162007230 19:7788515-7788537 AGTCCTCCCAAGTGACCCGGCGG + Intergenic
1166118295 19:40669075-40669097 ATGCCTCTGAGGTGACCCCGTGG + Intronic
1167587493 19:50383197-50383219 TGTCCAGGGAGGTGACCCTGAGG - Intergenic
925284149 2:2705026-2705048 AGGCCTGGGAGGTGCCCCAGTGG - Intergenic
934503305 2:94874881-94874903 GGTCCTCGGAGGTGTCGCGAAGG - Exonic
937142025 2:119610311-119610333 AGTCCTGGCAGGTGACCCAGTGG + Intronic
941714124 2:168745926-168745948 GGGCCTGGGAGGTGACCCAGAGG - Intronic
948642647 2:239385363-239385385 AGTCCTCGGAGGTGACCCGGAGG - Intronic
1172484883 20:35292103-35292125 GCTCCTCGGAGATGACCCGCAGG + Exonic
1176622731 21:9070309-9070331 GGTCCTCGGAGGTGTCGCGAAGG + Intergenic
1177833791 21:26169570-26169592 AAGCCTCGGAGGTGATCCGAGGG + Intronic
1183967120 22:41448380-41448402 AGTCCCTGGAGGTGCCCCCGGGG - Intergenic
956041756 3:65152385-65152407 GGTCCTGGGAGGTGAGGCGGGGG - Intergenic
959645270 3:108692287-108692309 AGTCCTGGGAGATGATCAGGAGG + Intronic
962270647 3:133975611-133975633 AGACCTGAGAGGTGACCAGGGGG - Intronic
962855873 3:139344176-139344198 CGGCCTCGGAGCTGAACCGGCGG - Exonic
968816653 4:2824949-2824971 TGTCCTGGGAGGTGCCCCTGTGG + Intronic
975690576 4:76958470-76958492 AGTCCTGGGAAGTGACCCAGGGG - Intronic
984111364 4:175619510-175619532 AGTCTTCGGAGATGACCATGTGG - Intergenic
997976693 5:138445350-138445372 AGTCCTCGATGGTGTCCAGGAGG - Exonic
1003293831 6:4806132-4806154 AGTCCTCTGAGGTCAGCAGGAGG + Intronic
1005024285 6:21447973-21447995 AGTCCTCGGTGGTACCCCAGAGG - Intergenic
1017696299 6:157019801-157019823 TATCCGCGGAGGTGACCCGCTGG - Intronic
1020278154 7:6637081-6637103 AGGTCTCGGAGGTGACCCCGAGG - Intergenic
1020690871 7:11353239-11353261 AGTCCTCGGAGATGACCTGTAGG + Intergenic
1028393486 7:90341309-90341331 AGACCTCGGTGGTGATCGGGAGG + Intronic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1033683978 7:143622183-143622205 GGTCCTCGGAAGGCACCCGGAGG - Intronic
1033687154 7:143701372-143701394 GGTCCTCGGAAGGCACCCGGAGG - Intronic
1033700634 7:143835455-143835477 GGTCCTCGGAAGGCACCCGGAGG + Intergenic
1038632980 8:29263087-29263109 ACTCTTCGGGGTTGACCCGGCGG + Intronic
1040395930 8:47000124-47000146 AGTCCTGGCAGGTAACCTGGCGG - Intergenic
1049291536 8:141805540-141805562 TGTCTTTGGAGGTGTCCCGGGGG + Intergenic
1049766178 8:144356271-144356293 AGTCCTGGGTGGTGGCCGGGCGG - Intronic
1051712492 9:19946178-19946200 AGTCCTTGGGGGTGAGCTGGGGG - Intergenic
1058671593 9:107364955-107364977 AGCCCTTCCAGGTGACCCGGAGG + Intergenic
1059409262 9:114122003-114122025 ACTCTGGGGAGGTGACCCGGGGG - Intergenic
1059421587 9:114195810-114195832 AGGCCTCAGAGGAGACTCGGGGG - Intronic
1061948332 9:133921118-133921140 AGTCCTTGGAGGGGAGACGGCGG + Intronic
1062307978 9:135920348-135920370 GGACCTGGGAGGTGACCCTGTGG + Intergenic
1062421708 9:136485548-136485570 AGTGCTGGGAGGTGTCCCGCCGG + Exonic
1062478557 9:136741325-136741347 AGTCCCAGGAGGTGATCCTGAGG - Exonic
1062556375 9:137114926-137114948 AGGCCGCGGAGATGGCCCGGGGG - Intronic
1062620005 9:137416453-137416475 AGACCTGGGAGGTGAGGCGGTGG - Intronic
1203745922 Un_GL000218v1:40737-40759 GGTCCTCGGAGGTGTCGCGAAGG + Intergenic
1187648301 X:21374046-21374068 AGGCCTCTGAGGGGACCCGGCGG - Intergenic
1189335502 X:40168574-40168596 AGGCCTCGGGGGTGCTCCGGCGG + Intronic
1200165686 X:154033604-154033626 AGTCCTAGGAGGTTTCACGGTGG - Intronic
1200794593 Y:7329257-7329279 ACTCATCTGAGGTGACCCGCTGG + Intergenic
1201159246 Y:11155749-11155771 GGTCCTCGGAGGTGTCGCGAAGG + Intergenic