ID: 948642886

View in Genome Browser
Species Human (GRCh38)
Location 2:239386480-239386502
Sequence CTCCCCTGGCCGGCCACCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 7, 3: 44, 4: 338}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948642886_948642897 12 Left 948642886 2:239386480-239386502 CCCGGGGTGGCCGGCCAGGGGAG 0: 1
1: 0
2: 7
3: 44
4: 338
Right 948642897 2:239386515-239386537 CTGGAGCCCACGGATGTTGGTGG 0: 1
1: 0
2: 5
3: 38
4: 253
948642886_948642898 13 Left 948642886 2:239386480-239386502 CCCGGGGTGGCCGGCCAGGGGAG 0: 1
1: 0
2: 7
3: 44
4: 338
Right 948642898 2:239386516-239386538 TGGAGCCCACGGATGTTGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 115
948642886_948642900 18 Left 948642886 2:239386480-239386502 CCCGGGGTGGCCGGCCAGGGGAG 0: 1
1: 0
2: 7
3: 44
4: 338
Right 948642900 2:239386521-239386543 CCCACGGATGTTGGTGGGTAAGG 0: 1
1: 0
2: 0
3: 6
4: 91
948642886_948642896 9 Left 948642886 2:239386480-239386502 CCCGGGGTGGCCGGCCAGGGGAG 0: 1
1: 0
2: 7
3: 44
4: 338
Right 948642896 2:239386512-239386534 CCTCTGGAGCCCACGGATGTTGG 0: 1
1: 0
2: 0
3: 4
4: 144
948642886_948642894 2 Left 948642886 2:239386480-239386502 CCCGGGGTGGCCGGCCAGGGGAG 0: 1
1: 0
2: 7
3: 44
4: 338
Right 948642894 2:239386505-239386527 TGCGAGGCCTCTGGAGCCCACGG 0: 1
1: 0
2: 1
3: 22
4: 210
948642886_948642893 -7 Left 948642886 2:239386480-239386502 CCCGGGGTGGCCGGCCAGGGGAG 0: 1
1: 0
2: 7
3: 44
4: 338
Right 948642893 2:239386496-239386518 AGGGGAGGGTGCGAGGCCTCTGG 0: 1
1: 0
2: 7
3: 43
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948642886 Original CRISPR CTCCCCTGGCCGGCCACCCC GGG (reversed) Intronic
900180096 1:1307557-1307579 CTGCCCTGTGCGGCCGCCCCGGG - Intronic
900289321 1:1917209-1917231 CTTCCCGGGCAGGCCTCCCCCGG - Exonic
900365431 1:2310249-2310271 CTCCCCAGACCGGCCACACACGG + Intergenic
900372402 1:2337790-2337812 CTCCCCTGTCCAGCCAGCTCTGG - Intronic
900379142 1:2375281-2375303 CTTCCCTGCCCGGCCCTCCCTGG + Intronic
900518089 1:3092693-3092715 TTCCTCTGGCTGGGCACCCCCGG + Intronic
900530243 1:3149465-3149487 CTGCCCTGCCCTGCCACTCCTGG + Intronic
900540315 1:3199474-3199496 CTCCCCTTCCTGCCCACCCCAGG + Intronic
900792546 1:4689870-4689892 CTCCCCTGACCTGCCCCTCCAGG - Intronic
901086343 1:6614218-6614240 TTCCCCTCGTCGGCCCCCCCGGG + Intronic
901795923 1:11679812-11679834 CCACCATGCCCGGCCACCCCCGG + Intronic
902338040 1:15765093-15765115 CTCCCAGGGGCGGCCACGCCGGG - Exonic
902664868 1:17930433-17930455 CTCCACTTCCCGGTCACCCCTGG + Intergenic
902916689 1:19644109-19644131 CTCTCCTGGCCCGCCCGCCCCGG - Intronic
903034487 1:20485460-20485482 CGTCCCCGGCCGGCCGCCCCCGG - Exonic
904492687 1:30870540-30870562 CTGCCCTGGCCGGCCTGACCGGG - Intronic
904959753 1:34323145-34323167 CTCCCATGCCTGGACACCCCAGG - Intergenic
905414400 1:37794428-37794450 CTCCCCTGGGCCGGCACCCGCGG + Exonic
907196704 1:52692944-52692966 ATCACCTGGCCTGCCACACCTGG - Intronic
907461718 1:54609241-54609263 GTCCGCTGGCCCACCACCCCTGG + Exonic
908015890 1:59835714-59835736 TTCCCCCTGCCCGCCACCCCGGG - Intronic
909869605 1:80722851-80722873 CCCCCTTGGCTGACCACCCCAGG - Intergenic
910580592 1:88819990-88820012 CTCCCCTAGCCCCCGACCCCCGG - Intronic
913962944 1:143353662-143353684 CTCCCCAGCCCCGCAACCCCGGG + Intergenic
914057299 1:144179247-144179269 CTCCCCAGCCCCGCAACCCCGGG + Intergenic
914121847 1:144787119-144787141 CTCCCCAGCCCCGCAACCCCGGG - Intergenic
914490067 1:148146320-148146342 CTCCCCTGCCGGGCCAGGCCGGG + Intronic
916888946 1:169097836-169097858 CTCCCCTAGCCCCCCACCCCTGG - Intergenic
919763879 1:201114438-201114460 CTCCCCAGGACGGTCATCCCTGG - Exonic
920818526 1:209358145-209358167 CTCCCCTAGCCCCCCACACCTGG - Intergenic
921248700 1:213275874-213275896 CTCCCCTGGCCCGCAGCCTCTGG + Intergenic
921390467 1:214608893-214608915 CTCCCCTGCCGGGCCAGGCCGGG - Intronic
922418928 1:225446683-225446705 CACCTCTGCCCAGCCACCCCAGG + Intergenic
922445323 1:225692126-225692148 TTCCCCTGGCCTGCCACACTTGG - Intergenic
922931658 1:229394869-229394891 CTCCCCTTGCCTCCCATCCCCGG - Intergenic
922987878 1:229880451-229880473 CTCCCGTGTGGGGCCACCCCAGG - Intergenic
924582610 1:245335320-245335342 CTCCCCTGGCCTGGCATCCCAGG + Intronic
1063211401 10:3884294-3884316 CACCCCAGGCCGCCCAGCCCTGG - Intergenic
1064384541 10:14878804-14878826 CGCCCCTGGCCGGCCCGCGCGGG - Intronic
1064561696 10:16600266-16600288 CTGCCCTGAGCTGCCACCCCAGG + Intronic
1064949670 10:20834375-20834397 TGCTCCTGGCCGTCCACCCCTGG + Intronic
1067831402 10:49612974-49612996 CTCCCCCGGGCGGCATCCCCGGG - Intronic
1070785020 10:79157797-79157819 CTCCCCTGGCGGGCCAGTGCTGG - Intronic
1072003592 10:91220925-91220947 CTGCCCTGGCCGGCCCAGCCTGG + Intronic
1072151975 10:92690668-92690690 CGCCCCTGGCCGGCCCCCGTGGG + Intronic
1072294171 10:93993813-93993835 CTCCCCCGCCCGGCCGCCCGCGG + Intergenic
1076199308 10:128545862-128545884 CACCCCTGCCTGGCCTCCCCAGG + Intergenic
1076334996 10:129700989-129701011 CTCTCCTGGCCCTCCACACCAGG + Intronic
1076663243 10:132069249-132069271 CTCCCCTGGCCTCCCACCCCTGG - Intergenic
1076720207 10:132389132-132389154 CTTCCCTGGCCGGCTGCCCACGG - Intergenic
1076735614 10:132457683-132457705 CTCCCCTGCCCTCCCTCCCCAGG - Intergenic
1076793358 10:132787772-132787794 CTCCCCCTGCCCGCCCCCCCCGG - Intergenic
1076858795 10:133129936-133129958 CGGCCCTGCCCGGCCACACCAGG - Exonic
1077152137 11:1077214-1077236 CTCCGCTGGCCGGGCTTCCCCGG - Intergenic
1077333490 11:1993522-1993544 TTCCCCTGCCCCGCCACCCTGGG + Intergenic
1077488562 11:2850183-2850205 CAGCCCCGGCCGCCCACCCCGGG + Intergenic
1077560685 11:3258384-3258406 CTCCCCTGCAGGGCCACCCCAGG - Intergenic
1077566581 11:3304212-3304234 CTCCCCTGCAGGGCCACCCCAGG - Intergenic
1079630364 11:22666996-22667018 CTCCCCTCCCCCGCCGCCCCGGG - Intronic
1083232601 11:61332810-61332832 CACTCCTGCCCGGCCGCCCCCGG + Intronic
1083621851 11:64053183-64053205 CTCCCCAGCACGCCCACCCCAGG - Intronic
1083811803 11:65110600-65110622 CTCCCCTGACCAGCCAGACCTGG - Exonic
1083894795 11:65614390-65614412 CTCTCCTGGCCCGCCTACCCGGG - Intronic
1084323982 11:68388545-68388567 CACCCCTGAGCTGCCACCCCAGG + Intronic
1084588999 11:70079355-70079377 CTCCCCTGGGCGCCCAGGCCTGG + Intronic
1084859932 11:72011648-72011670 CTCTCCTACCCAGCCACCCCAGG - Intronic
1084904371 11:72334657-72334679 CTCCCCTTGCCTCCCACCCAGGG + Intronic
1085524643 11:77157229-77157251 CTCCTCTGGCCCTCCTCCCCTGG + Intronic
1085884976 11:80511079-80511101 CTCCCCTAGCCCCCCACCCCAGG - Intergenic
1088626973 11:111736499-111736521 CTCCAAGGGCTGGCCACCCCTGG + Intronic
1089624426 11:119742328-119742350 CACCCCTGCCCACCCACCCCCGG - Intergenic
1089730346 11:120515126-120515148 CTCCCCTGGCCACCCAGCCCTGG + Intronic
1090395213 11:126414257-126414279 CTGCCCTGGCCGGGCTCCCACGG - Exonic
1090732383 11:129583039-129583061 CTGGGCTGGCTGGCCACCCCTGG + Intergenic
1090884276 11:130862134-130862156 CTCCCAAGTCCGGCCACGCCCGG - Intergenic
1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG + Intronic
1202816470 11_KI270721v1_random:48704-48726 TTCCCCTGCCCCGCCACCCTGGG + Intergenic
1091727076 12:2853782-2853804 CTCCCCCTCCCGGCCACCCTGGG - Intronic
1091744484 12:2982476-2982498 CTCCCCTGGCAGGCCCTCCTGGG + Intronic
1091912819 12:4245437-4245459 CCCCCCTCTCTGGCCACCCCTGG + Intergenic
1093666947 12:21825641-21825663 CTCCCCTAGCCCCCCACCCCCGG - Intronic
1093894516 12:24562058-24562080 GTCCCCCGGCCAGCCGCCCCCGG + Intergenic
1100384339 12:94091686-94091708 CCCTCCTGGCCCTCCACCCCAGG - Intergenic
1100869468 12:98895074-98895096 CCCGCCTCGCCGCCCACCCCGGG - Intronic
1101628062 12:106465606-106465628 CTCCCCTAGCCTCCCACCCCAGG + Intronic
1101845128 12:108357516-108357538 CTCCCCTGACCACCCACCTCTGG - Intergenic
1102424168 12:112827746-112827768 CTCCCCTGGCCCCCCACCCCAGG - Intronic
1102434106 12:112907226-112907248 CTCCCCTGGCCAGGCAGGCCTGG - Intronic
1103566823 12:121820245-121820267 CTCACCTGGCCCAGCACCCCAGG - Intronic
1103680539 12:122690262-122690284 CACACCTGCCCAGCCACCCCAGG + Intergenic
1103698573 12:122835733-122835755 CGCCCCTGGCCGGCGCCTCCCGG - Intronic
1104423318 12:128654948-128654970 GTCCCCTGCCCTGCCACCTCGGG + Intronic
1104450457 12:128864542-128864564 CTCCCATGGCTGCCCACTCCTGG - Intronic
1105349467 13:19602315-19602337 CGACCCCGGCGGGCCACCCCGGG - Intergenic
1112839685 13:103560911-103560933 CTCCCCTAGCCCCCCAACCCCGG - Intergenic
1113009472 13:105747316-105747338 CTACCCTAGCCCCCCACCCCGGG - Intergenic
1116817827 14:49599697-49599719 CTCCCCGTCCCGGCCTCCCCAGG - Intronic
1117623189 14:57608786-57608808 CTCCCCCCGCCGCCCCCCCCCGG - Intronic
1120190472 14:81435908-81435930 CTCCCCTCGCCTGAAACCCCGGG - Intronic
1122083080 14:99280409-99280431 CTCCCCTGCCCTGCAAACCCTGG + Intergenic
1122411283 14:101527376-101527398 CTCCTCTGTCCTGCCACCCAGGG - Intergenic
1122779692 14:104138487-104138509 CGCCCCTCGCCGCCCGCCCCGGG + Intergenic
1122789169 14:104177147-104177169 AGCCCCTGGGCGGCCTCCCCGGG + Exonic
1122970638 14:105150777-105150799 CTCACCTGGCTGGCCCGCCCAGG - Exonic
1123682961 15:22775773-22775795 CTGCCCTCACCGGTCACCCCAGG - Intronic
1124168637 15:27352619-27352641 CTTCCTTGGCCTGCCTCCCCGGG - Intronic
1124334708 15:28848296-28848318 CTGCCCTCACCGGTCACCCCAGG - Intergenic
1124378250 15:29142138-29142160 CTCCCCTGGCTGGCTTCCCCTGG + Intronic
1124960419 15:34389436-34389458 CTGCCCTCGCCGATCACCCCGGG - Intronic
1124964502 15:34423217-34423239 CTCCCCTGCCCTACCACCACAGG + Intronic
1124977048 15:34535657-34535679 CTGCCCTCGCCGATCACCCCGGG - Intronic
1124981122 15:34569443-34569465 CTCCCCTGCCCTACCACCACAGG + Intronic
1125490788 15:40147108-40147130 CACCCCTGACCCTCCACCCCAGG - Intergenic
1125834377 15:42736862-42736884 CTGCCCGGGCCGCCCACCCGAGG - Intronic
1125885376 15:43225740-43225762 CTACCCTGACCGTCCACACCTGG - Intergenic
1126686210 15:51251064-51251086 CTTCCCAGGCCTGCCACGCCCGG + Intronic
1127389920 15:58497286-58497308 CTCCCCTCCCCTGCCACCCGTGG + Intronic
1128071823 15:64802095-64802117 CTCCCCTGGCCGGCAAGCAGGGG - Intergenic
1129152736 15:73699384-73699406 CTTCCCTGTCAGGCCTCCCCAGG + Intronic
1129201888 15:74007672-74007694 CACCCCAGGGCAGCCACCCCAGG - Intronic
1129664823 15:77573695-77573717 CTGCCCTGGACTGCCAGCCCAGG - Intergenic
1129672288 15:77613999-77614021 TTCCCCTGCCCGGCCGCCCGGGG + Exonic
1130076791 15:80696089-80696111 CTCTCCTGGCAGGCCGCCCCAGG - Intronic
1131269013 15:90935352-90935374 GAGCCCCGGCCGGCCACCCCCGG + Exonic
1131936681 15:97513724-97513746 CTCCCCTGGCCCCCCACCCCTGG - Intergenic
1132651201 16:1022136-1022158 CTCCCCTGGTCAGCCAGCCCTGG - Intergenic
1132701024 16:1222191-1222213 CTCACCTGGCAGGCATCCCCGGG + Exonic
1132743558 16:1427643-1427665 CTCGCCCCTCCGGCCACCCCTGG + Intergenic
1133771409 16:8868910-8868932 CGCCCCTGGCCCGCGGCCCCGGG - Intronic
1134172155 16:11977003-11977025 CTCCCGTGGCGGGGCACTCCTGG + Intronic
1134441540 16:14302151-14302173 CTCCCCAGCGCGGCCAACCCCGG + Intergenic
1135488477 16:22886542-22886564 CTCCCTTGGCTGGGCACCCTTGG + Intronic
1136458479 16:30395561-30395583 CTCACCTTGCCGGCCGCCTCCGG - Exonic
1136707754 16:32202878-32202900 CACCCCGCGCCGGCCCCCCCAGG + Intergenic
1136760155 16:32726533-32726555 CACCCCGCGCCGGCCCCCCCAGG - Intergenic
1136807949 16:33143853-33143875 CACCCCGCGCCGGCCCCCCCAGG + Intergenic
1137548097 16:49417958-49417980 CTCCCTTCCCCTGCCACCCCTGG - Intergenic
1137551692 16:49441721-49441743 CTCCACCGGCCTGCCAACCCAGG - Intergenic
1138351605 16:56348900-56348922 CTCCCCTGCACTGCCACTCCTGG + Intronic
1139516339 16:67454467-67454489 CTCCCTTGGCCTGCTTCCCCCGG - Intronic
1139516462 16:67455135-67455157 ATCCCCTGGGCAGCCTCCCCAGG - Intronic
1140701697 16:77587341-77587363 GCCCCCCGGCCCGCCACCCCAGG + Intergenic
1141035506 16:80622205-80622227 CACCCCTGCCTGTCCACCCCTGG - Intronic
1141172076 16:81697840-81697862 CACTCCTCGCCGGCCACCCCAGG + Intronic
1141694437 16:85613034-85613056 CTCACCTGGCCGGCCGGGCCGGG + Intronic
1141702640 16:85649627-85649649 CTCTCCCGGCCCCCCACCCCTGG + Intronic
1141890607 16:86924376-86924398 CTCCCCTGGGCGTAGACCCCTGG - Intergenic
1142279480 16:89140260-89140282 CTCCCCTGGCCAGGTGCCCCGGG + Intronic
1203062309 16_KI270728v1_random:986855-986877 CACCCCGCGCCGGCCTCCCCAGG - Intergenic
1142718628 17:1762165-1762187 CTCCCCTGTCCCCCCAGCCCAGG - Intronic
1143096341 17:4480501-4480523 CTTCCCTGGCCTGCCCCCCACGG + Intronic
1143211592 17:5191946-5191968 CTCCCCTGGCCGTCTCCCACCGG + Intergenic
1144806730 17:17972607-17972629 CTCCCCTGGCCCGCCCCCAAAGG + Intergenic
1145190670 17:20840972-20840994 CTCCCCTGCCGGGCCAGGCCGGG + Intronic
1146186337 17:30726939-30726961 CTCCCCTCGTCGCCCAGCCCTGG - Intergenic
1147179347 17:38674622-38674644 CGCCCCCGGCCCGCCACCCGGGG + Exonic
1148438983 17:47702143-47702165 CTCCCCTGTCCTTCCACCCAAGG + Intronic
1148559486 17:48597681-48597703 CTCCCCTGGGCGCCCACCCCGGG - Intronic
1149641578 17:58206251-58206273 CTCCCCCAGCTGGCCACCCCAGG - Intronic
1149849483 17:60026590-60026612 CCCCGCTGGCCGGCCGCTCCGGG + Intergenic
1149860685 17:60119934-60119956 CCCCGCTGGCCGGCCGCTCCGGG - Intergenic
1149998417 17:61416927-61416949 CTCCCCTGGCCGCGCTTCCCTGG - Intergenic
1151541715 17:74768013-74768035 ATGCCCTGGCCACCCACCCCTGG - Intronic
1151656839 17:75500133-75500155 CTCCCTTTGCCAGCCACCGCCGG - Intergenic
1152353408 17:79795468-79795490 CTACCCTGGCCGCTCGCCCCAGG - Exonic
1152564960 17:81096272-81096294 CTTTCCGGGCCGGCCACCGCTGG + Intronic
1152628736 17:81400111-81400133 CTTCCCTGGCCACCCTCCCCCGG + Intronic
1152719826 17:81918002-81918024 CTCCCCGGCCCGGCCATGCCCGG - Intronic
1152729040 17:81960976-81960998 CACCCCCGGCCCGGCACCCCCGG - Exonic
1153408753 18:4770053-4770075 CTCCCTTGGCCCGCCACACCTGG - Intergenic
1155633726 18:27925696-27925718 CTCCCCTAACCCCCCACCCCCGG + Intergenic
1157294231 18:46431036-46431058 CTCCTCTTGCCCCCCACCCCTGG + Intronic
1159961002 18:74555627-74555649 CTCCCCAGCCCGTCCACCTCTGG - Intronic
1160177874 18:76610997-76611019 CTCCCCGGCCCCGCCACCCCAGG - Intergenic
1160227656 18:77023753-77023775 CTCCCAGGGCCAGCCTCCCCAGG - Intronic
1160242363 18:77132820-77132842 CTCCCCGGCCCCGCCTCCCCGGG + Intronic
1160517483 18:79486591-79486613 CTCGCCCGGGCAGCCACCCCCGG + Exonic
1160995837 19:1881619-1881641 CTCCCCTGCCGGGCCAGGCCGGG - Exonic
1161029626 19:2051588-2051610 CTCCCTTGGCCTGTCAACCCAGG + Intergenic
1161112322 19:2477265-2477287 CTGCCCTGCCCCGCCACGCCCGG + Intronic
1161221455 19:3119964-3119986 CTCCCCTGGCCGCCATCCCCAGG - Intronic
1161470704 19:4455634-4455656 CTCCCGTGGCCTGTCTCCCCTGG + Intronic
1161722118 19:5908953-5908975 CTGCCGCCGCCGGCCACCCCTGG + Exonic
1161767233 19:6214454-6214476 CTCCCCTGGCCGCCTGACCCTGG + Intronic
1162056275 19:8065976-8065998 CCCCTCTGGCTGGACACCCCAGG + Exonic
1162972509 19:14189111-14189133 CTCCCCTTGTCGCCCAGCCCTGG + Intronic
1163664820 19:18598301-18598323 CTCCCCAGCCCGGCAACTCCCGG - Intronic
1163719780 19:18893661-18893683 CTCCCCAGGCCGGGCAGCACTGG + Intronic
1163957897 19:20661133-20661155 CTCCCCTGCCCACCCTCCCCTGG + Intronic
1165095558 19:33407931-33407953 CACCCCCAGCCAGCCACCCCCGG - Intronic
1166361326 19:42254039-42254061 CTCCCCTCCCCCGCCGCCCCCGG - Intronic
1166942112 19:46373569-46373591 CTTCCCAGCCCGCCCACCCCTGG + Intronic
1166945459 19:46393545-46393567 CCCCCGTGCCCGGCCAGCCCTGG - Intergenic
1167887768 19:52516188-52516210 CTCCCATGCCCTCCCACCCCTGG + Intergenic
1168129750 19:54310714-54310736 CTCCACTGGCCGGCAGCCCCAGG - Intronic
1202696782 1_KI270712v1_random:131920-131942 CTCCCCAGCCCCGCAACCCCGGG + Intergenic
925718852 2:6809185-6809207 CTCCCCTCTCCAGCCACACCAGG + Intergenic
927300176 2:21503190-21503212 CTCCCCTAGCCCTCCACCCCTGG + Intergenic
927531760 2:23811595-23811617 CTCCCCTGGCCTCCCACCCCCGG - Intronic
928016692 2:27664181-27664203 TTCCCCTGGCGGTCCAGCCCGGG + Exonic
928077814 2:28281167-28281189 CTCCCCTGGGCTGCCCCCACCGG + Intronic
929830504 2:45343186-45343208 CTCCACTGCCTGCCCACCCCAGG + Intergenic
929966811 2:46542753-46542775 CTCCCCGGCCCGGCCTCCCCAGG - Exonic
931657733 2:64524878-64524900 CTTCCCTCCCCGGCCACCGCCGG + Intronic
931885198 2:66609787-66609809 CTCCCCCTGCCCCCCACCCCAGG + Intergenic
932015099 2:68017820-68017842 CTCCCCCAGCCCACCACCCCCGG - Intergenic
932104530 2:68930711-68930733 CTCCCCCAGCCCCCCACCCCCGG - Intergenic
932434378 2:71694629-71694651 CTCCCCCGGCAGGCCTCTCCAGG - Intergenic
932467940 2:71935362-71935384 CTCCCCTGGCAGGCCTACCAGGG + Intergenic
932718379 2:74120208-74120230 CTCCCCCGCCCGCCCAACCCCGG + Intergenic
933876016 2:86623014-86623036 CGTCACTGGCCGGCCATCCCCGG + Exonic
934277935 2:91588934-91588956 CTCCCCAGCCCCGCAACCCCGGG + Intergenic
934649602 2:96083414-96083436 GGCCCCTGGCTGGCCAGCCCCGG - Intergenic
934789960 2:97050753-97050775 CTCTCCTGGCCTGTCACCTCTGG + Intergenic
936059014 2:109282506-109282528 CTCCCCTGTCCTCCCACCGCAGG - Intronic
936519322 2:113201842-113201864 CTCCCCTGGCTGGGCTGCCCAGG - Exonic
938338880 2:130522700-130522722 CTCCCCTGGGCGGCCACGTTCGG + Intronic
938350958 2:130598050-130598072 CTCCCCTGGGCGGCCACGTTCGG - Intronic
938455567 2:131460702-131460724 CTCCCCGGCCTGGCCAACCCAGG - Intergenic
938822724 2:134975575-134975597 CTCCCCTTGCCCACCACCACCGG - Intronic
940041816 2:149369185-149369207 CTCCCGTGGCCTGTAACCCCGGG - Intronic
941021086 2:160408060-160408082 CTCCCCGGGCCGCCCGGCCCCGG - Intronic
941973900 2:171382552-171382574 CTCCCCTTGCCCTCCACCCCTGG - Intronic
943379932 2:187132037-187132059 CTCCCCTAGACCCCCACCCCTGG - Intergenic
944179091 2:196867473-196867495 CTCCCTTAGCCGCCCACCCCTGG - Intronic
945115857 2:206407350-206407372 CTCCCCCAGCCTCCCACCCCAGG + Intergenic
945441908 2:209889635-209889657 CTCCCATAGCCCGCCACCCACGG + Intronic
946339615 2:219059165-219059187 CGACACTGGCCGGCCAGCCCCGG + Intronic
947713406 2:232328444-232328466 CTGCCCTGGCAGGCCCACCCTGG + Intronic
948011362 2:234651880-234651902 CTCCCCTGACCCACCCCCCCGGG + Intergenic
948047300 2:234953747-234953769 CTCACCTGGCCGTCCTGCCCAGG + Intronic
948516992 2:238510229-238510251 CTCCACCTCCCGGCCACCCCAGG + Intergenic
948642886 2:239386480-239386502 CTCCCCTGGCCGGCCACCCCGGG - Intronic
948757234 2:240166821-240166843 CACCCCTGCCTGGCCTCCCCAGG - Intergenic
948800072 2:240429529-240429551 CTCCCTTGGCCGCCCTCCCTGGG + Intergenic
948846664 2:240686186-240686208 CCCTCCTGGCCGGCAGCCCCTGG + Intergenic
948859279 2:240745106-240745128 CTGCCCTGGCTGAGCACCCCCGG + Intronic
1169262430 20:4148719-4148741 CTCCCCGGGCCCGCCCCGCCGGG - Intronic
1171351311 20:24505261-24505283 CTCCCCTGGCTGCGCACCCTTGG - Intronic
1171879995 20:30611427-30611449 CTCTCCTGGCCCGACAGCCCAGG - Intergenic
1172109562 20:32537049-32537071 CTGCCCTGCCCCGCCCCCCCGGG + Intronic
1172364725 20:34340206-34340228 CTCCTCTGGCCTGACTCCCCAGG + Intergenic
1172618883 20:36306940-36306962 CTCCCGTGCCCGGCCAACCTTGG + Intronic
1173108392 20:40160357-40160379 CCCCCATGGCCGCCCAGCCCTGG - Intergenic
1173420049 20:42892990-42893012 CTCCCCTGCAAGGCCTCCCCTGG - Intronic
1174143023 20:48430184-48430206 CTCCTCTGGGCTGCCTCCCCTGG + Intergenic
1174193036 20:48753806-48753828 CTCCTCTCACAGGCCACCCCTGG + Intronic
1174386397 20:50190590-50190612 CACCCCCGCCCGGCCGCCCCGGG - Intergenic
1174931131 20:54816171-54816193 CTCCCCTAGCCCCCCACCCCTGG - Intergenic
1175816040 20:61883702-61883724 CTCTCTTGGCCCCCCACCCCTGG - Intronic
1175831068 20:61965783-61965805 CTCCCCGGGCCCCCCGCCCCTGG + Intronic
1175933034 20:62502407-62502429 CACCCCTAGCAGGCCAGCCCAGG - Intergenic
1177220395 21:18185166-18185188 CTCCCCTAGCCCCCTACCCCTGG + Intronic
1179545255 21:42109072-42109094 CTCCGCTGGACCCCCACCCCCGG + Intronic
1179899407 21:44381215-44381237 CTCCCCAGGCCAGCCACACCTGG - Intronic
1180625641 22:17191875-17191897 CACCCCTGCCCAGCCACCCCTGG + Intronic
1181121618 22:20671037-20671059 CTCCCCTGCCCGGCCAGGCCGGG - Intergenic
1181313156 22:21956329-21956351 CTCCCCTCCCCAGCCACCCGAGG - Intergenic
1181317154 22:21978222-21978244 CTCCCATGTCCCGCCATCCCAGG - Intronic
1181346261 22:22222401-22222423 CTCCCCTCCCCAGCCACCCGAGG - Intergenic
1181802725 22:25358037-25358059 CACCCCTGAGCTGCCACCCCAGG - Intronic
1182014193 22:27025471-27025493 CTCCCCTGGCCGGTCACCCAGGG - Intergenic
1183018440 22:35008533-35008555 TTCCCCTAGCCAGCCACACCCGG + Intergenic
1183357536 22:37367622-37367644 CTGCCCTGGCCTCCCACACCCGG - Intergenic
1183517080 22:38272857-38272879 CCCGCCTGGCCGGCCTCGCCCGG - Intronic
1184404002 22:44289707-44289729 CTCCCCTGGCCTGCCACGGCTGG + Intronic
1185014154 22:48333702-48333724 CTCCCATGAAGGGCCACCCCGGG - Intergenic
1185087634 22:48749346-48749368 CTCCCCTGGCCATCCACGCCGGG - Intronic
1185097885 22:48821568-48821590 CTCCCCTGGCCAGCCCCAGCCGG + Intronic
1185222541 22:49636255-49636277 CTCCCCAGGGCGGCCCACCCTGG - Intronic
1185413381 22:50697401-50697423 CTCCCCTCGCCGCCGACCCCCGG - Intergenic
1185416284 22:50712207-50712229 CTCCCCTGGCCAAAGACCCCAGG + Intergenic
950477139 3:13221528-13221550 AGCCCCTGCCCGCCCACCCCAGG + Intergenic
950546339 3:13640229-13640251 CTCACCCTGCAGGCCACCCCCGG + Intergenic
952644497 3:35639364-35639386 CTGCTCTGGCCGGAGACCCCGGG - Intronic
953982933 3:47421760-47421782 CTCAGCTGGCCTGCCAGCCCTGG + Intronic
954402648 3:50327258-50327280 CTCCCCTGACCCCACACCCCAGG + Intronic
954638348 3:52083769-52083791 CTTCCCAGGCCGGGCAGCCCTGG - Intronic
960423142 3:117474091-117474113 CTCCCCTTGGCGGCTACTCCCGG - Intergenic
962398031 3:135034683-135034705 CTGCCTTGGCAGGGCACCCCAGG - Intronic
963022155 3:140882787-140882809 CTCCCCTAGCCCCCCACTCCTGG - Intergenic
966477073 3:180361530-180361552 CTCCCCTAGCCCCCCACCCCCGG + Intergenic
968258099 3:197297704-197297726 CTGCCCTGTCCGGCCCCCGCTGG - Intronic
968503297 4:960989-961011 CTCCCATGGCCGGCCCAGCCCGG + Intronic
968620602 4:1601913-1601935 CTCCCCTGGCCCACCTCCCCAGG - Intergenic
968631560 4:1654716-1654738 CAAGCCTGGCCGGCCACCCTGGG + Intronic
968648769 4:1752275-1752297 TTCCCCTGGGAGGCCACACCTGG + Intergenic
968957877 4:3728323-3728345 CTCCCCCTGCCAGTCACCCCCGG + Intergenic
969032804 4:4227402-4227424 CTCCCCAGTCCCGCAACCCCGGG - Intergenic
969259415 4:6024047-6024069 CTGCCTTGGGAGGCCACCCCTGG - Intergenic
969530214 4:7726266-7726288 CTCCCCAGGCCTGCCCCCCACGG - Intronic
969559552 4:7938874-7938896 CTCCCCTGGCCGGCGGGCCCCGG - Intronic
969671618 4:8593096-8593118 CTCCCCTGGACGGGGACACCAGG + Intronic
971392548 4:26199568-26199590 CTCCCCTCCCCAGCCACTCCAGG - Intronic
975449827 4:74511318-74511340 CTCCCCTAGCCCCTCACCCCCGG - Intergenic
976145928 4:82043091-82043113 CTCTCCCGGCCAGCCACTCCAGG - Intronic
976768046 4:88618964-88618986 CTCCCCTGGCTGGACACACAAGG - Intronic
985150943 4:186946368-186946390 CCCCCCTGCCCCGCCACCGCAGG - Intergenic
985810297 5:2078225-2078247 CTCCAGGGTCCGGCCACCCCCGG + Intergenic
986393561 5:7306307-7306329 CTGCCCTCACCGGTCACCCCAGG - Intergenic
991090774 5:62691803-62691825 CTCCGCTGGCTGGGCAGCCCAGG - Intergenic
991957466 5:72009951-72009973 CTTCCCAGGCTGTCCACCCCGGG + Intergenic
993447168 5:88027536-88027558 CTGCCCTGCCTTGCCACCCCAGG + Intergenic
997364897 5:133319414-133319436 CTCCCTTGGCCTCCCACCACAGG - Intronic
997479912 5:134177111-134177133 ATCCCCCGGCCAGCCGCCCCCGG - Intronic
997583720 5:135032972-135032994 CTGCCCGCGCCGGCCACCCGCGG + Intronic
999261657 5:150242137-150242159 GTCCCCCTCCCGGCCACCCCAGG - Intronic
999666226 5:153916525-153916547 CTCCCCTGGCACTCCATCCCAGG + Intergenic
999828791 5:155299472-155299494 CTGCCCTGGCTGCCCAGCCCTGG + Intergenic
1000423885 5:161068323-161068345 CTCCCCCTGCCCCCCACCCCAGG + Intergenic
1001260060 5:170220689-170220711 CTCAGCTGGCTGGCCAACCCTGG + Intergenic
1002167858 5:177359236-177359258 CTCTCCCAGCCGGCCAGCCCGGG - Intronic
1002175354 5:177398323-177398345 CTCCCCTGCCTTTCCACCCCAGG - Exonic
1002429547 5:179195065-179195087 CTTCCCTGACCAGCCGCCCCAGG + Intronic
1002661393 5:180792983-180793005 GTCCCCTGGCCTGCCCTCCCCGG - Exonic
1002851950 6:1004096-1004118 CTCCCCTGCCAGGCCCCTCCTGG + Intergenic
1002897667 6:1389098-1389120 CCTCCCTGGCCGCCCTCCCCAGG - Intergenic
1002898531 6:1392819-1392841 CTCCCGCGGCCGGCCTTCCCTGG + Intronic
1005184698 6:23152400-23152422 TTCCCCTGTCCCTCCACCCCTGG + Intergenic
1006814143 6:36839475-36839497 CTCCCCTTGCCGCCCAGCCCAGG - Exonic
1006914895 6:37587862-37587884 CTTCCCTGGCCAGTCACTCCCGG + Intergenic
1007120315 6:39375197-39375219 CTCTCCTGACCTCCCACCCCTGG - Intronic
1007663579 6:43501314-43501336 CTCCCCTGACCCTCCAACCCAGG + Intronic
1007739141 6:44000513-44000535 CTCCCCTGGCCTGCCGCGGCGGG - Intergenic
1008920994 6:56843875-56843897 CTCCCCAGGCCCGCCCACCCTGG + Intronic
1011686562 6:89828705-89828727 CACCCACGCCCGGCCACCCCTGG - Intergenic
1019111816 6:169723691-169723713 CCCGCCTCGCCGACCACCCCCGG + Intronic
1019286737 7:227027-227049 CTCCCCAGGCCGTCCGACCCTGG + Intronic
1019427092 7:982997-983019 CTCCCCTCCCCGGCCCCACCAGG + Intergenic
1019433980 7:1012363-1012385 TTCCCCTCGCCATCCACCCCAGG - Intronic
1019472589 7:1229535-1229557 CCCCTCTGGCCCGCCAGCCCCGG - Intergenic
1019562552 7:1665834-1665856 CCCGCCTGCCCGGCCAGCCCCGG + Intergenic
1022195174 7:28058314-28058336 TTCCTCTGGCTGGCCACCCCAGG - Intronic
1022207812 7:28180367-28180389 CCCTCCCCGCCGGCCACCCCTGG + Intronic
1023205292 7:37742388-37742410 CTCCCCTAGCCCCCCACCCCTGG + Intronic
1024216715 7:47254594-47254616 CGCCCCCTGCCGGCCACACCGGG + Intergenic
1024569055 7:50709370-50709392 CTCCCTCGGCCGCCCACCACTGG - Intronic
1026898444 7:74023896-74023918 CTTTCCTGGCCGGCCATCCGAGG + Intergenic
1027570445 7:79859449-79859471 CTCCCCTAGCCCCCCACCCCCGG - Intergenic
1028787413 7:94811355-94811377 CCCCCCTGCCCTGCCTCCCCAGG - Intergenic
1029604413 7:101590110-101590132 TTCCCCTTGCCGGCCTCCCCTGG + Intergenic
1030086324 7:105819026-105819048 CTCCCCCAGCCCCCCACCCCCGG + Intronic
1032093411 7:128923432-128923454 CTCCTCTGGCCAGCCAGCCGGGG - Intergenic
1032222761 7:130006985-130007007 CCCGCCTGGCCTGCCACCCGAGG - Intergenic
1034194131 7:149233011-149233033 CTCCCCTGGCCCAGGACCCCTGG - Intergenic
1034201459 7:149285447-149285469 CTGCCCAGGCCGGCCAGCACAGG + Intronic
1034869959 7:154675205-154675227 CTCCCCTAGCCCCCCGCCCCCGG - Intronic
1035327851 7:158076379-158076401 CTCCCCAGGGAGGCCACGCCAGG - Intronic
1035388031 7:158487698-158487720 CACCCCTGGCCCGCCAGCCTCGG + Intronic
1036694194 8:10964145-10964167 CTCCCCTGACCTACCTCCCCAGG + Intronic
1038242170 8:25819936-25819958 TTCACTTGGACGGCCACCCCAGG + Intergenic
1039454616 8:37698459-37698481 CTCCCCCCGCCCGCCGCCCCCGG + Exonic
1042591566 8:70402973-70402995 CGCCCCTCGCCCCCCACCCCCGG + Intronic
1043479776 8:80641303-80641325 CTGCCCTGGCCTGCCACTGCAGG - Exonic
1044233269 8:89803558-89803580 CTCCCCTTGCCTTCCACCCCCGG + Intergenic
1044622523 8:94204295-94204317 CTCCGCTTGCCTCCCACCCCAGG + Intronic
1048976315 8:139674868-139674890 TTCCCCTGGCCTGGCACCCCAGG + Intronic
1049508912 8:143018226-143018248 GTCCCCTGTCCGGCCTCGCCAGG + Intronic
1049556265 8:143283719-143283741 CGGCCCTGGCCCGCCACCCTTGG + Intergenic
1049597040 8:143489496-143489518 CTCCCCTGGCCCCTCTCCCCTGG - Intronic
1049988648 9:973188-973210 ATCCCCGGGCCGGTGACCCCGGG + Intergenic
1053014644 9:34654874-34654896 CTGCCCTTGGCGCCCACCCCTGG - Intronic
1053467718 9:38322629-38322651 CTCCCCTAGCCCCCCACCCCCGG + Intergenic
1056846756 9:90044996-90045018 CTCCACTGGCCCGGCACACCGGG - Intergenic
1057141800 9:92731000-92731022 CCACCCTGGCCAGCCACCCCGGG + Intronic
1060588280 9:124800251-124800273 CTCCTCTGGCCAGTCACCCTTGG + Intronic
1061017361 9:127989602-127989624 CTGCCCTGACCACCCACCCCAGG - Intergenic
1061886172 9:133592074-133592096 CTCCCTTGGCCAGCCTCCCCAGG + Intergenic
1062428136 9:136515466-136515488 CCCGCCTGGCCGGCCACCTGTGG + Exonic
1062610620 9:137371763-137371785 ATCCCCTGGCAGGACACCCCCGG + Intronic
1187669697 X:21656622-21656644 CTCCCCTGGCCGACGACTCGCGG - Exonic
1188720021 X:33510715-33510737 CTCCCCCAGCCCCCCACCCCCGG - Intergenic
1189234297 X:39475761-39475783 CCCTCCTGCCAGGCCACCCCAGG - Intergenic
1189321518 X:40090323-40090345 CCCCGCAGGCCGGCCACCCCTGG + Intronic
1189355639 X:40308101-40308123 CTCCCCTGGCCTGACAGTCCTGG - Intergenic
1190161912 X:48038205-48038227 CTCCCCTTGCCTCTCACCCCTGG - Intronic
1190220423 X:48509143-48509165 ATCCCTGGGCCGGCCTCCCCAGG + Intronic
1190511072 X:51174984-51175006 CTCCCCTTGCCCCCCACCCCTGG - Intergenic
1191824706 X:65352315-65352337 TTCCCCTAGCCTCCCACCCCCGG - Intergenic
1192229910 X:69257574-69257596 CACCTCTGGCCTGCCACTCCAGG + Intergenic
1192636576 X:72825360-72825382 CTCCCCCAGCCCCCCACCCCCGG + Intronic
1192645138 X:72895454-72895476 CTCCCCCAGCCCCCCACCCCCGG - Intronic
1192894000 X:75420802-75420824 CTCCCCTAGCTCCCCACCCCAGG - Intronic
1198806656 X:140501374-140501396 CTCCCCTGGCCCCTCAACCCGGG - Intergenic
1198943344 X:141982688-141982710 TTCCACTGGCAGGCCTCCCCAGG + Intergenic
1199377138 X:147126656-147126678 CTCCCCTAGCCCCCCAACCCCGG + Intergenic
1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG + Intronic
1200099981 X:153685506-153685528 CTCCCCACGTCGGCCACCCTGGG - Intronic
1200692989 Y:6326976-6326998 CTCCTCTAGCCCTCCACCCCTGG - Intergenic
1201042283 Y:9847750-9847772 CTCCTCTAGCCCTCCACCCCTGG + Intergenic