ID: 948645787

View in Genome Browser
Species Human (GRCh38)
Location 2:239403041-239403063
Sequence CTGTGTATAAGGAGAAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 915
Summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 847}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948645787 Original CRISPR CTGTGTATAAGGAGAAAGGT GGG Intergenic
900075833 1:816966-816988 TTTTGTATATGGTGAAAGGTAGG - Intergenic
900573124 1:3369524-3369546 CTGGGTATGAGGAGAAAGGATGG + Intronic
900722313 1:4185231-4185253 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
901213306 1:7538847-7538869 CAGTGTCAAAGTAGAAAGGTGGG - Intronic
901244814 1:7721514-7721536 AGGTGGATGAGGAGAAAGGTTGG + Intronic
901958213 1:12803129-12803151 TTTTGTATAAGGTGAAAGGAAGG + Intergenic
901966208 1:12869029-12869051 TTTTGTATAAGGTGAAAGGAAGG + Intronic
902051116 1:13564214-13564236 CTATGTGTAATGAAAAAGGTCGG - Intergenic
904453476 1:30632079-30632101 CTGTGTATATGGAGAAACTGAGG - Intergenic
904961439 1:34336383-34336405 TTGTGAATGAGGAGACAGGTTGG + Intergenic
905060284 1:35134321-35134343 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
905429478 1:37911001-37911023 CTGTGTGTAATGAAAAAGGTTGG - Intronic
905487370 1:38312124-38312146 TTTTGTATATGGTGAAAGGTAGG - Intergenic
906904037 1:49868578-49868600 TTTTGTATAAGGTGTAAGGTAGG - Intronic
906947817 1:50310435-50310457 GTGTGTGTCAGGAGAGAGGTTGG - Intergenic
907053175 1:51343450-51343472 CTGTGTCTGAGAAGAAAGGAGGG - Intronic
907591506 1:55676806-55676828 TTTTGTATATGGTGAAAGGTAGG + Intergenic
907926142 1:58956802-58956824 CTGGGTATAGGGAGAAAGGAAGG - Intergenic
909303765 1:74046425-74046447 TTTTGTATAAGGTGTAAGGTAGG - Intronic
909729694 1:78876175-78876197 CTCTGTATAATGATAAGGGTTGG - Intergenic
909775605 1:79481053-79481075 TTTTGTATAAGGTAAAAGGTAGG - Intergenic
910003217 1:82361893-82361915 TTGTGGCTAGGGAGAAAGGTGGG - Intergenic
910308005 1:85788731-85788753 CTTTGTATAAGGTGTAAGGAAGG + Intronic
910517967 1:88084912-88084934 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
910929799 1:92431932-92431954 TTTTGTATAAGGTGAAAGGAAGG + Intergenic
911071381 1:93834493-93834515 CTGTGTGTAATGAAAAAGGTTGG - Intronic
911231394 1:95365139-95365161 TTTTGTATATGGTGAAAGGTAGG - Intergenic
911984065 1:104599695-104599717 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
912299183 1:108496164-108496186 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
912614297 1:111082130-111082152 TTTTGTATATGGAGAAAGGTAGG + Intergenic
912615357 1:111094797-111094819 CTTTGTATAAGGTGTAAGGAAGG - Intergenic
913245388 1:116865986-116866008 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
914247810 1:145898878-145898900 CTGAGAATGAGGAGAAAGCTGGG - Intronic
914668170 1:149849959-149849981 TTGTGTATATGAACAAAGGTTGG - Intronic
915460119 1:156065398-156065420 GTGTGGGTAAGGAGAAAGTTTGG - Intronic
915582138 1:156820144-156820166 TTTTGTATAAGGAGAGAGATGGG + Intronic
915826553 1:159084334-159084356 CTGTGTGAAAGGAGAAGGGAAGG - Intronic
916751214 1:167724270-167724292 GTGTATATAAGGGGAATGGTGGG + Intronic
917042039 1:170815731-170815753 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
917355973 1:174126634-174126656 TTTTGTATAAGGCGAAAGGAAGG + Intergenic
917512757 1:175681797-175681819 TAGGGTAGAAGGAGAAAGGTGGG + Intronic
917584439 1:176411826-176411848 TTTTGTATAAGGTGAAAGGAAGG + Intergenic
917749893 1:178043699-178043721 CTGTGTGTAATGAAAAGGGTCGG - Intergenic
918135896 1:181673748-181673770 CTGTGTTTCAGGAGAGGGGTGGG - Intronic
918219285 1:182421253-182421275 TTTTGTATATGGTGAAAGGTAGG + Intergenic
918284688 1:183040628-183040650 CTGGGTTTCAGGAGAAAGGCTGG + Intronic
918787485 1:188781467-188781489 ATGTGTATAAAGACAAAGGTAGG - Intergenic
920425643 1:205872943-205872965 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
920427114 1:205887300-205887322 CTGTGTGTAACGAAAAGGGTTGG + Intergenic
920550097 1:206853059-206853081 TTTTGTATATGGTGAAAGGTAGG - Intergenic
920603069 1:207348740-207348762 TTTTGTATATGGTGAAAGGTAGG + Intronic
920908247 1:210190994-210191016 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
921109773 1:212023883-212023905 TTTTGTATATGGTGAAAGGTAGG + Intronic
921205346 1:212844056-212844078 CTGTGTGTAATGAAAAAGTTGGG - Intronic
921300591 1:213748022-213748044 CTGTGTATGAGGAGCCAGGTGGG + Intergenic
921620805 1:217324246-217324268 CTGTTATTAAGGACAAAGGTTGG + Intergenic
921942468 1:220856410-220856432 CTGACTCTCAGGAGAAAGGTGGG - Intergenic
922046665 1:221951799-221951821 CTGTGTGTAAGGAAAAAGGTTGG - Intergenic
922147524 1:222962750-222962772 TTTTGTATAAGGAGTAAGGAAGG - Intronic
922599251 1:226837140-226837162 CTGTGTGTAAGGAAAAAGGATGG - Intergenic
922845165 1:228679000-228679022 CTGTGTGTAATGAAAAAGGTTGG + Intergenic
923345752 1:233050653-233050675 TTTTGTATATGGTGAAAGGTAGG - Intronic
924893618 1:248312072-248312094 TTTTGTATAAGGTGTAAGGTGGG + Intergenic
1063244637 10:4205571-4205593 CTGTCTTTCAGGAGAAAGGACGG + Intergenic
1063363390 10:5474828-5474850 CTGTGTGTCATGAAAAAGGTTGG - Intergenic
1063920405 10:10926747-10926769 CTGTCAGCAAGGAGAAAGGTAGG + Intergenic
1064150566 10:12860565-12860587 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1064313355 10:14232100-14232122 TTTTGTATATGGAGAAAGGAAGG + Intronic
1064344079 10:14514924-14514946 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1064618913 10:17194127-17194149 TTTTGTATATGGTGAAAGGTAGG - Intronic
1064916145 10:20460848-20460870 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
1065103792 10:22358752-22358774 TTTTGTATAAGGAGTAAGGAAGG + Intronic
1065429735 10:25641107-25641129 CTGTGTACAAGGAGAAGGCCCGG - Intergenic
1065841682 10:29706809-29706831 CTTTGTATAAGGTGTAAGGAAGG + Intronic
1066184873 10:32999566-32999588 TTTTGTATATGGTGAAAGGTAGG + Intronic
1066436948 10:35404336-35404358 CTGTGTGTAATGAAAAGGGTTGG + Intronic
1067179362 10:43973226-43973248 CAGGGCATATGGAGAAAGGTAGG - Intergenic
1067996280 10:51277132-51277154 TTTTGTATAAGGTGTAAGGTAGG + Intronic
1068179420 10:53501025-53501047 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1068313181 10:55305865-55305887 ATGTCTACAAGGAGGAAGGTAGG - Intronic
1068338762 10:55673483-55673505 TTCTGTATATGGTGAAAGGTAGG + Intergenic
1068640532 10:59400293-59400315 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1068826754 10:61448866-61448888 CTGAGAATAAGTAGAAAGCTAGG - Intronic
1069255862 10:66331237-66331259 TTGTGTATAAGGTGTAAGGAAGG + Intronic
1069782606 10:70966191-70966213 CTGTCTACACTGAGAAAGGTTGG - Intergenic
1071550593 10:86563601-86563623 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1071821973 10:89288425-89288447 CTGTGTGTAATGAAAAGGGTTGG - Intronic
1071892969 10:90032242-90032264 CTTTGTATAAAGTGAAAGGTGGG - Intergenic
1071894130 10:90046226-90046248 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1072025854 10:91455743-91455765 TTTTGTATAAGGTGAAAGGAAGG + Intronic
1072410555 10:95198168-95198190 CTGTGTCTATGTAGAAAGGGAGG - Intronic
1072672977 10:97445247-97445269 CTCTGTAGCAGGAGAAAGCTTGG + Intronic
1073014215 10:100385111-100385133 CTGTGTGTAATGAAAAAGTTGGG - Intergenic
1073394941 10:103209776-103209798 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1073576856 10:104633341-104633363 CTGTGTTCAAGTAGCAAGGTTGG - Intergenic
1073683713 10:105730723-105730745 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1073704514 10:105968065-105968087 CTGAGTATAAGGTGAAAGCAGGG + Intergenic
1074288811 10:112122851-112122873 CTGTGTCTAAGGAGGTAGGAAGG + Intergenic
1074406406 10:113183668-113183690 CTGTGCACAAGGAGCAAGGCCGG - Intergenic
1074664420 10:115703230-115703252 TTTTGTATATGGTGAAAGGTAGG - Intronic
1075300461 10:121318091-121318113 CTTTGTATATGGTGTAAGGTAGG + Intergenic
1075481604 10:122787128-122787150 CTGGGAATAAGGAGTCAGGTGGG + Intergenic
1076189443 10:128472625-128472647 ATGTGTTTCAGGAGTAAGGTAGG - Intergenic
1076409741 10:130237771-130237793 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1076768469 10:132650573-132650595 CTGTGTAAATGGAGAGAGGTCGG + Intronic
1077588541 11:3473486-3473508 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1077597560 11:3547049-3547071 CTGTGTTTAAGGTGAGAAGTGGG - Intergenic
1077762026 11:5112055-5112077 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1077853628 11:6099861-6099883 CTGTGGATACAGAGCAAGGTGGG + Intergenic
1077986019 11:7351824-7351846 CTGAGAGTAAGGAGAAAGGAAGG + Intronic
1078162979 11:8857826-8857848 CTGTCTATAAACAGAAAGATTGG + Intronic
1078272232 11:9806736-9806758 CTGTGTGTGGGGTGAAAGGTTGG + Intronic
1078789252 11:14526339-14526361 CTGTGTGTAATGAAAAGGGTTGG - Intronic
1079525031 11:21376218-21376240 TTTTGTATATGGTGAAAGGTAGG + Intronic
1079690331 11:23408998-23409020 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1079696553 11:23489000-23489022 CTGTGTATAAGGTATAAGGAAGG - Intergenic
1079904857 11:26232602-26232624 TTTTGTATAAGGTGTAAGGTAGG - Intergenic
1079961066 11:26924023-26924045 CTTTGTATATGGTGAAAGGCAGG + Intergenic
1080709103 11:34729177-34729199 TTTTGTATATGGTGAAAGGTGGG + Intergenic
1081159959 11:39738282-39738304 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1081602385 11:44504198-44504220 GTGTGTGTAGGAAGAAAGGTAGG - Intergenic
1082186793 11:49191961-49191983 CTGTGTATAAAAAAACAGGTTGG - Intronic
1082240940 11:49869865-49869887 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1083440779 11:62674921-62674943 CTGACTATAAGTAGAAAGGTTGG + Intergenic
1083501223 11:63110018-63110040 TTTTGTATAAGGTGTAAGGTAGG + Intronic
1083861626 11:65423124-65423146 CTGTGTGGAAGGAGGAAGGCAGG + Intergenic
1084203340 11:67576793-67576815 ATGTGTTCAAGGAGGAAGGTGGG + Intergenic
1084244245 11:67845115-67845137 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1084585702 11:70060833-70060855 CTGTGTGTAAGGAAAAAGGATGG + Intergenic
1084828444 11:71749447-71749469 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1084841375 11:71853246-71853268 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1085490674 11:76914019-76914041 TTTTGTATAAGGAGTAAGGAAGG - Intronic
1085533447 11:77204737-77204759 CTGGGTGTAAGGAGAGAGGGTGG - Intronic
1085570450 11:77553756-77553778 CTGTGTGTAATGAAAAAAGTTGG - Intronic
1085627525 11:78084648-78084670 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1086133341 11:83422453-83422475 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1086531486 11:87791604-87791626 TTGTGTACATGGTGAAAGGTAGG - Intergenic
1086737503 11:90324190-90324212 CTTTGTATATGGTGAGAGGTAGG + Intergenic
1087099870 11:94353347-94353369 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1087107751 11:94428358-94428380 TTTTGTATATGGTGAAAGGTAGG - Intronic
1087167838 11:95022492-95022514 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1087366639 11:97228107-97228129 TTTTGTATAAGGTGAGAGGTAGG + Intergenic
1087880888 11:103415136-103415158 TTTTGTATAAGGTGTAAGGTAGG - Intronic
1088021560 11:105125710-105125732 CTGTGTAAAAGGAGATATTTTGG - Intergenic
1088072777 11:105810670-105810692 CTGTATCTCAGGAGGAAGGTCGG - Intronic
1088385600 11:109251310-109251332 CTGTGTCTTAAAAGAAAGGTGGG - Intergenic
1088446715 11:109938220-109938242 CTGTGTTTAAGGACAATGGGAGG - Intergenic
1088555188 11:111053906-111053928 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1089818099 11:121194765-121194787 CTGAGTTTTAGGAGAAAGGCTGG - Intergenic
1089953569 11:122550834-122550856 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1090340022 11:126009474-126009496 CTGTCTAGAAGGAGGAATGTGGG + Intronic
1090429106 11:126631036-126631058 CTGTGTATGAGAAGAAAGATTGG - Intronic
1090526578 11:127544732-127544754 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1090546265 11:127771075-127771097 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1090690058 11:129171341-129171363 TTTTGTATAAGGTGAAAGGAAGG + Intronic
1090724797 11:129515254-129515276 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1090895250 11:130966404-130966426 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1091030040 11:132178140-132178162 CTATCTGTAAGGAGACAGGTTGG - Intronic
1091114737 11:133002706-133002728 ATGTGTATAGGGAGAAAGAGAGG + Intronic
1091183913 11:133630510-133630532 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1092414806 12:8282256-8282278 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1092423736 12:8356343-8356365 CTGTGTTTAAGGTGAGAAGTGGG - Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092803453 12:12195860-12195882 TTTTGTATAAGGTGAGAGGTGGG + Intronic
1093239076 12:16646809-16646831 CTGTGTATGAAGAGAAAGAAAGG + Intergenic
1093358689 12:18198830-18198852 CTGTGTGTAATGAAAAGGGTTGG - Intronic
1093476119 12:19556419-19556441 TTTTGTATATGGAGAAAGATAGG + Intronic
1094792939 12:33935385-33935407 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1095032994 12:37319047-37319069 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1095051640 12:37559857-37559879 GTTTGTATATGGTGAAAGGTAGG - Intergenic
1095244316 12:39901159-39901181 CTTTGTATAAGGTGTAAGGAAGG - Intronic
1095508468 12:42923889-42923911 TTATGTATAAGGAGAAAATTGGG + Intergenic
1095778424 12:46033861-46033883 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1095905697 12:47375680-47375702 CTTTGTATATGGTGAAAAGTAGG - Intergenic
1095998782 12:48112120-48112142 CTGTGTGTAATGAAAAGGGTTGG + Intronic
1096291266 12:50345518-50345540 TTTTGTATATGGTGAAAGGTAGG + Intronic
1096787408 12:54025312-54025334 CTGTCTATAGGGGGAAAGCTGGG - Intronic
1096798269 12:54092047-54092069 CTGGGTTTAAGGTGAGAGGTTGG - Intergenic
1096874489 12:54616564-54616586 CTGTCCACAAGGAGAAAGGGAGG + Intergenic
1096920447 12:55079840-55079862 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1096953901 12:55505865-55505887 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
1097070984 12:56354773-56354795 CTGGACAAAAGGAGAAAGGTGGG - Exonic
1097524085 12:60708401-60708423 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1097620846 12:61937626-61937648 TTTTGTATAAGGTGAAAGATAGG - Intronic
1097882749 12:64700860-64700882 TTTTATATAAGGATAAAGGTGGG + Intergenic
1098563321 12:71902549-71902571 TTTTGTATATGGTGAAAGGTAGG - Intronic
1098629796 12:72710889-72710911 CTGTGGATAATGAAAAGGGTTGG + Intergenic
1098720833 12:73895625-73895647 TTTTGTATAAGGTGAAAGGAAGG + Intergenic
1098858171 12:75677809-75677831 CTGTGTATTAAAAGAAATGTTGG - Intergenic
1099060419 12:77901394-77901416 TTTTGTATACGGTGAAAGGTAGG + Intronic
1099381775 12:81963352-81963374 ATTTGTATATGGTGAAAGGTAGG - Intergenic
1099432393 12:82603416-82603438 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1099600854 12:84735576-84735598 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1099706590 12:86161476-86161498 TTTTGTATATGGTGAAAGGTAGG - Intronic
1099762824 12:86942520-86942542 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1099792842 12:87358883-87358905 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1099994074 12:89757756-89757778 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1100952829 12:99871089-99871111 TTTTGTATATGGTGAAAGGTAGG + Intronic
1102116520 12:110407274-110407296 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1102129467 12:110514892-110514914 CTATGTATAAGAAAGAAGGTAGG + Intronic
1103508118 12:121454968-121454990 CTGTATTTGAGGAGAAAGGGGGG - Intronic
1105032485 12:132893586-132893608 CTGTGTGTAATGAAAAGGGTTGG - Intronic
1105445364 13:20450410-20450432 TTTTGTATATGGTGAAAGGTAGG - Intronic
1107143714 13:37034074-37034096 CTGAGAAGAAGGAGAAAGATAGG - Intronic
1107158378 13:37196624-37196646 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1107220063 13:37971167-37971189 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1108155715 13:47583020-47583042 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1108260883 13:48654939-48654961 ATATGTATTAGGAGAAAGGGAGG + Intronic
1109216494 13:59595594-59595616 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1109358999 13:61271396-61271418 TTTTGTATAAGGTGAAAGGAAGG - Intergenic
1109450526 13:62508131-62508153 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1109679925 13:65737974-65737996 TTTTGTATATGGTGAAAGGTGGG - Intergenic
1110001946 13:70213695-70213717 CTTTGTATAAGGTGTAAGGAAGG - Intergenic
1110126673 13:71952132-71952154 CTTTGTATAAGGTGTAAGGAAGG - Intergenic
1110491211 13:76110310-76110332 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1110635139 13:77758596-77758618 TTTTGTATAAGGTGAGAGGTAGG + Intronic
1110750463 13:79109065-79109087 CTGTGTATAAGCACAACAGTAGG + Intergenic
1111600688 13:90470345-90470367 TTTTGTATAAGGTGAAAGGAGGG + Intergenic
1111943482 13:94638730-94638752 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1112129759 13:96509515-96509537 TTTTGTATAAGGTGAAAGATAGG + Intronic
1112237060 13:97646014-97646036 CTGTGTATAATGAAAAGGGTTGG - Intergenic
1113131217 13:107039234-107039256 TTTTGTATAAGGTGAAAGGAAGG + Intergenic
1113173683 13:107536047-107536069 TTTTGTATAAGGTGTAAGGTAGG - Intronic
1114221929 14:20704443-20704465 CTGTGTGTAAGGAAAAAGAATGG - Intergenic
1115303280 14:31908509-31908531 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1115947658 14:38680706-38680728 TTTTGTATAAGGAGAGAGATAGG + Intergenic
1116018921 14:39438420-39438442 CTTTTTATATGGTGAAAGGTAGG + Intergenic
1116179911 14:41519665-41519687 CTGTGTGTAATGAAAAGGGTCGG - Intergenic
1116190039 14:41653333-41653355 TTTTGTATAAGGTGTAAGGTAGG + Intronic
1116550112 14:46226753-46226775 TTTTGTATAAGGTGAAAGGAAGG - Intergenic
1116574420 14:46554657-46554679 TTGTGTATATGGTGAAAGGTAGG + Intergenic
1117617918 14:57552916-57552938 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1117926167 14:60781771-60781793 TTGTGTATAGGGTGAAAGATAGG + Intronic
1117957678 14:61135414-61135436 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1119248072 14:73130150-73130172 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1120083871 14:80246854-80246876 CTTTGTATAAGGTGTAAGGAAGG + Intronic
1120659700 14:87236865-87236887 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1122358749 14:101143639-101143661 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
1122367226 14:101201323-101201345 CTGTGTATGAGGCGTAAGCTGGG - Intergenic
1123452196 15:20375372-20375394 GTTTGTATAAGGTGAAAGGAAGG - Intergenic
1124551902 15:30688898-30688920 CTGTGCATATGGACAAAGGGAGG - Intronic
1124679345 15:31716773-31716795 CTGTGCATACGGACAAAGGGAGG + Intronic
1124814346 15:32973902-32973924 CTGTGTATCTGGATAAAGGAGGG - Intronic
1125212990 15:37238213-37238235 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1125359835 15:38853393-38853415 CTTTGTATAAGGTGTAAGGAAGG - Intergenic
1125822753 15:42646944-42646966 CTGAGTAGAGGGAGAAAGGTAGG + Intronic
1126343562 15:47669635-47669657 CTATGCATAAGGAGATCGGTGGG - Intronic
1126844005 15:52742465-52742487 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1126885925 15:53150028-53150050 CTGGGAATAGGGAGAAAGATAGG - Intergenic
1127003690 15:54541109-54541131 CTCTGGATAAAGAGGAAGGTTGG - Intronic
1127326481 15:57900420-57900442 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1127743879 15:61943610-61943632 TTTTGTATATGGTGAAAGGTAGG - Intronic
1127814193 15:62592095-62592117 ATGTGTATAAGGAGGAGGGTGGG + Intronic
1128078863 15:64844368-64844390 CTTTGTAAAAGGAAAAGGGTGGG + Intronic
1128826975 15:70728197-70728219 TTTTGTATATGGTGAAAGGTAGG - Intronic
1129223267 15:74147763-74147785 TTTTGTATAAGGAGTGAGGTGGG + Intergenic
1129477871 15:75798453-75798475 CTGTGAAGAAGGTGAAAGGAAGG + Intergenic
1129697323 15:77748046-77748068 TTGTGTGGAAGGGGAAAGGTTGG - Intronic
1130030052 15:80305336-80305358 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1130137906 15:81197124-81197146 CTGTGCATAGGGAGGTAGGTGGG + Intronic
1131684940 15:94758187-94758209 CTGTGGATAATGAAAAGGGTTGG - Intergenic
1132263250 15:100444009-100444031 CTGTGTGTAATGAAAAGGGTTGG - Intronic
1133837790 16:9381916-9381938 CTGGGTATAAGGAAAAAGGAGGG - Intergenic
1135025216 16:18994496-18994518 CTGTGTGTAATGAAAAGGGTGGG + Intronic
1135226767 16:20666916-20666938 TTTTGTATATGGCGAAAGGTAGG - Intronic
1136993008 16:35168381-35168403 CTTTGTATAAGGTGTAAGGAAGG - Intergenic
1137342133 16:47618644-47618666 CTGTTTATAAGAATAAAGGATGG - Intronic
1137343045 16:47628993-47629015 TTTTGTATAAGGTGTAAGGTAGG - Intronic
1137363671 16:47842284-47842306 CTGTGTGTAATGAAAAAGGTTGG - Intergenic
1137498344 16:48989378-48989400 TTCTGTATATGGTGAAAGGTAGG - Intergenic
1137578407 16:49619090-49619112 CAGAGTATAAGAAGTAAGGTGGG - Intronic
1139202730 16:64995563-64995585 TTTTGTATATGGGGAAAGGTAGG - Intronic
1139342987 16:66282437-66282459 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1139386328 16:66574336-66574358 CTGTGTCTAAGGCAAAAGGGAGG + Intronic
1139592379 16:67940479-67940501 CTGTGGATATGGAGCAAGGTGGG + Intronic
1140065029 16:71603995-71604017 CTTTGTATAAGGTGTAAGGAAGG + Intergenic
1140514732 16:75533712-75533734 CTGTGTAAAAGGAGAGAGAAAGG + Intronic
1144383290 17:14724527-14724549 CAGGGTATCAGGAGCAAGGTAGG - Intergenic
1145372278 17:22316764-22316786 GTTTGTATATGGTGAAAGGTAGG - Intergenic
1145715218 17:27013116-27013138 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1147029961 17:37625291-37625313 CTGTTTATAAGAAGAAAGCAAGG - Intronic
1148046398 17:44747637-44747659 CTGAGGATAAGGGGAAAGGAAGG - Intronic
1148776389 17:50097790-50097812 CTGTGTTTCCAGAGAAAGGTGGG - Intronic
1149136832 17:53376770-53376792 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1149147250 17:53509614-53509636 TTTTGTATATGGAGAGAGGTAGG - Intergenic
1149147798 17:53518792-53518814 TTCTGTATATGGTGAAAGGTAGG + Intergenic
1149220745 17:54413230-54413252 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1150018887 17:61590168-61590190 CTGTGTCTTAGGACAAAGATGGG + Intergenic
1150178715 17:63091381-63091403 TTTTGTATAAGGTGAAAGGAAGG + Intronic
1150885047 17:69075414-69075436 TTTTGTATATGGTGAAAGGTGGG + Intergenic
1150894114 17:69189692-69189714 TTTTGTATAGGGTGAAAGGTAGG + Intronic
1151502974 17:74504075-74504097 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1153024336 18:659035-659057 CAATGTCTAAGCAGAAAGGTGGG - Intronic
1153072275 18:1119007-1119029 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1153532606 18:6064027-6064049 TTTTGTATAAGGTGAAAGATGGG + Intronic
1153550826 18:6259958-6259980 TTTTGTATATGGTGAAAGGTAGG + Intronic
1153606174 18:6835771-6835793 TTCAGAATAAGGAGAAAGGTGGG + Intronic
1153974587 18:10257125-10257147 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1155207189 18:23570297-23570319 CTGATAATATGGAGAAAGGTTGG + Intronic
1155383834 18:25254817-25254839 CTGTGTATGAAAAGAAAGGTGGG - Intronic
1155856875 18:30845436-30845458 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
1155962195 18:32003956-32003978 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1156302489 18:35847639-35847661 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1156593626 18:38520402-38520424 CTGTGTTAAAGGAGATAGGAAGG + Intergenic
1156765989 18:40656035-40656057 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1156958424 18:42994597-42994619 CTGTGTGTAATGAAAAGGGTTGG - Intronic
1157448140 18:47763478-47763500 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1161065389 19:2235075-2235097 CTGTGTAGAAGGGGAAATGTGGG + Intronic
1162251837 19:9451441-9451463 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1162262482 19:9544120-9544142 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1163209926 19:15832695-15832717 CTGTGTGTAAGGAAAAAGGTTGG - Intergenic
1163899950 19:20092445-20092467 CTGTGTGTAATGAAAAGGGTTGG + Intronic
1164003829 19:21131609-21131631 CTGTGTATAGTGAAAAGGGTTGG + Intergenic
1164259019 19:23553125-23553147 CTGTGTGTAAGGAAAAAGGATGG - Intronic
1164360636 19:27504386-27504408 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1164448634 19:28339325-28339347 CTTTTTATATGGTGAAAGGTAGG + Intergenic
1164592291 19:29513484-29513506 GGGGGTATAAGGAGAAAGGAGGG + Intergenic
1165078446 19:33293864-33293886 CTGTGTTTCTGGTGAAAGGTTGG + Intergenic
1165572577 19:36787867-36787889 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1166905515 19:46105890-46105912 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1166926899 19:46275326-46275348 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
925911199 2:8574658-8574680 CTGTGTCCAAGGAGGAAGGCGGG + Intergenic
926885042 2:17589421-17589443 CTGTGCAGAAGGAGAGTGGTTGG + Intronic
926940709 2:18133700-18133722 CTATATCTAAGGAGAAAGTTGGG - Intronic
927016380 2:18966754-18966776 TTTTGTATATGGTGAAAGGTAGG + Intergenic
927266171 2:21153644-21153666 TTTTGTATAAGGTGTAAGGTAGG - Intergenic
928381012 2:30818638-30818660 TTTTGTATAAGGAGTAAGGAAGG - Intronic
928827426 2:35439091-35439113 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
930098805 2:47587472-47587494 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
930212676 2:48658272-48658294 TTTTGTATATGGTGAAAGGTAGG + Intronic
930499943 2:52201909-52201931 TTTTGTATAAGGTGAGAGGTGGG - Intergenic
931815343 2:65895219-65895241 TTTTGTATAAGGTGTAAGGTAGG - Intergenic
932159199 2:69445478-69445500 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
932296076 2:70624331-70624353 CTGTGTGTAATGAAAAGGGTTGG - Intronic
932908281 2:75778204-75778226 TTTTGTATAAGGTGAAAGGAAGG - Intergenic
932922922 2:75938288-75938310 TTTTGTATATGGTGAAAGGTAGG + Intergenic
932973717 2:76575841-76575863 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
933093653 2:78151270-78151292 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
933107126 2:78344622-78344644 TTTTGTATATGGTGAAAGGTAGG + Intergenic
933138175 2:78761624-78761646 CTGTGTATAATGAAAAGGGTTGG - Intergenic
933527513 2:83461751-83461773 TTTTGTATACGGAGAAAGGTAGG + Intergenic
934141566 2:89052233-89052255 CTGTGTGTAAGGAAAAAGCATGG - Intergenic
934227677 2:90148310-90148332 CTGTGTGTAAGGAAAAAGCATGG + Intergenic
935131652 2:100265288-100265310 CTGGGGAGAAGGAGAAGGGTGGG - Intergenic
935197662 2:100828566-100828588 TTTTGTATATGGTGAAAGGTAGG + Intronic
935917237 2:107968351-107968373 CTTTGTATAAGGTGTAAGGAAGG + Intergenic
936079866 2:109424786-109424808 TTGTGTCTAAGGGAAAAGGTAGG - Intronic
937020926 2:118654317-118654339 TTTTGTATATGGAGCAAGGTAGG - Intergenic
937120675 2:119438210-119438232 CTGTGTATTAGCAGTCAGGTGGG - Exonic
937466200 2:122135179-122135201 CTGTGTAGCAGGGGAGAGGTGGG + Intergenic
937594741 2:123659935-123659957 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
938238702 2:129726335-129726357 ATCTGAGTAAGGAGAAAGGTCGG - Intergenic
938783206 2:134603811-134603833 GTGTATATAAGGTGGAAGGTGGG + Intronic
938999324 2:136715559-136715581 CTTTGCATAAGGTAAAAGGTAGG - Intergenic
939238691 2:139531379-139531401 CTGTGTGGAAGGAGAGAGATTGG + Intergenic
939575813 2:143893369-143893391 CTGTGTCTATGGAGACAAGTCGG - Intergenic
939647647 2:144720659-144720681 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
940183958 2:150962188-150962210 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
940603051 2:155885172-155885194 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
940703223 2:157072572-157072594 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
940775941 2:157884136-157884158 CTGTTTAAAAAAAGAAAGGTTGG + Intronic
941124241 2:161566858-161566880 TTTTGTATAAGGAGTAAGGAAGG + Intronic
941391705 2:164923045-164923067 TTTTGTATATGGAAAAAGGTAGG - Intronic
942730057 2:179053754-179053776 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
942907210 2:181198435-181198457 CTGTGTAGAAGGGAAAGGGTGGG - Intergenic
943093665 2:183403482-183403504 TTTTGTATAAGGTGAAAGGAAGG + Intergenic
943163543 2:184285718-184285740 CTTTGTATAAGGTGTAAGGAAGG - Intergenic
943500554 2:188683516-188683538 TTTTGTATATGGTGAAAGGTGGG + Intergenic
943697916 2:190956292-190956314 TTTTGTATAAGGTGAAAGGAAGG + Intronic
944123978 2:196272924-196272946 CTCTGGATAAGAAGAAATGTAGG - Intronic
944602621 2:201319331-201319353 TTTTGTATATGGTGAAAGGTAGG - Intronic
945173711 2:207021125-207021147 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
945193143 2:207211162-207211184 TTTTGTATATGGTGAAAGGTAGG - Intergenic
945301221 2:208218062-208218084 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
945554925 2:211265198-211265220 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
946196689 2:218036332-218036354 CTTTGTGTAAGGAGAGAGTTGGG + Intronic
946200960 2:218070513-218070535 CTTTGTGTAAGGAGAGAGCTGGG + Exonic
946780814 2:223191827-223191849 CTGTGTGTAATGAAAAGGGTTGG + Intronic
948055740 2:235008196-235008218 ATGTGTATAAGCTGAAAGGAAGG + Intronic
948645787 2:239403041-239403063 CTGTGTATAAGGAGAAAGGTGGG + Intergenic
948833045 2:240608342-240608364 CTGAGTATAGTGAGAAAGTTTGG + Intronic
949081883 2:242107740-242107762 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1168943049 20:1729735-1729757 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1170178314 20:13497956-13497978 TTTTGTATATGGTGAAAGGTAGG - Intronic
1170227577 20:14008941-14008963 CTGTGTATAAGGTGTAAGGAAGG - Intronic
1170325255 20:15149819-15149841 CTGTGTGTAATGAAAAGGGTTGG + Intronic
1170680202 20:18519593-18519615 CTGTGTGTAATGAAAAGGGTTGG + Intronic
1171155650 20:22870760-22870782 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1171546174 20:26003401-26003423 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1171798138 20:29582294-29582316 CTGGGTTTAAGGTGAGAGGTTGG + Intergenic
1171850100 20:30301867-30301889 CTGGGTTTAAGGTGAGAGGTTGG - Intergenic
1172136360 20:32689414-32689436 GTGTCTATAAGGAGAGAGGAAGG + Intergenic
1172549784 20:35789858-35789880 CTGTGTATAAAAAAAAAGGGGGG - Intronic
1172923138 20:38504403-38504425 TTTTGTATATGGTGAAAGGTAGG - Intronic
1173171240 20:40725737-40725759 CTGTCTTTAAGGAGAAAGAAGGG - Intergenic
1173206562 20:40999354-40999376 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1173494558 20:43509145-43509167 CTGAGTATAAAGAAAAAAGTGGG - Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1175017546 20:55808066-55808088 TTTTGTATAAGGTGAAAGGAAGG + Intergenic
1175041398 20:56054855-56054877 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1177102908 21:16917710-16917732 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1177116763 21:17095339-17095361 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1177236730 21:18400551-18400573 TTTTGTATATGGTGAAAGGTAGG - Intronic
1177466925 21:21496783-21496805 TTTTGTATATGGTGAAAGGTAGG + Intronic
1177705596 21:24699946-24699968 CTTTGTATAAGGTGCAAGGAAGG + Intergenic
1178812556 21:35897536-35897558 TTGTGTATAAGGTGTAAGGAAGG - Intronic
1179031361 21:37722756-37722778 CTTTGTATATGGTGAAAGGTAGG - Intronic
1180577854 22:16797140-16797162 TTTTGTATATGGTGAAAGGTAGG - Intronic
1181347834 22:22233256-22233278 CTGTGTTTCAGGAGAGAGCTTGG - Intergenic
1182274930 22:29182089-29182111 CTGGGAATCAGGAGAGAGGTGGG + Intergenic
1182985798 22:34714959-34714981 GTGTGTATATGGACAGAGGTGGG - Intergenic
1183635397 22:39059302-39059324 CTGTGTGTAATGAAAAGGGTTGG + Intronic
1184380681 22:44143349-44143371 ATGTGTGAAAGGAGAAAGGCAGG - Intronic
949370977 3:3334429-3334451 CTGGGAATAAGGAAAAATGTTGG + Intergenic
949427490 3:3935012-3935034 TTTTGTATAAGGAGTAAGGAAGG - Intronic
949506886 3:4737041-4737063 CTGTGGCTAAGGATAAAGATTGG - Intronic
949593366 3:5516919-5516941 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
949973457 3:9432071-9432093 CTGAGTATTAGGAAACAGGTGGG - Intronic
950763744 3:15257839-15257861 CTGTTTTTAAAGAGAAAGGGGGG - Intronic
950955588 3:17050152-17050174 TTCTGTATAAGGAGAGAGATAGG - Intronic
951060223 3:18197926-18197948 TTTTGTATATGGTGAAAGGTAGG + Intronic
951095921 3:18631104-18631126 TTTTGTATATGGTGAAAGGTAGG - Intergenic
951172514 3:19558174-19558196 GTGTGTATAAGGTGTAAGGAAGG + Intergenic
951175243 3:19591434-19591456 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
951261005 3:20508566-20508588 TTTTGTATATGGTGAAAGGTAGG + Intergenic
951316084 3:21191189-21191211 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
951567788 3:24028915-24028937 CTATTTATAAGGAGTCAGGTGGG - Intergenic
951628619 3:24694289-24694311 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
951672201 3:25197236-25197258 TTGTGTATAAGGTGTAAGGAAGG + Intronic
951675997 3:25242476-25242498 CTTTGTATAAGGTGAAAGGAAGG + Intronic
951687154 3:25357682-25357704 CTTTGTATAAGGTGTAAGGAAGG + Intronic
951762555 3:26162368-26162390 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
951988715 3:28651281-28651303 CTGTCTACAATGAGAAAGGGAGG - Intergenic
952297129 3:32071459-32071481 CTGTGTGTAATGAAAAGGGTTGG - Intronic
952470493 3:33645245-33645267 CTGGGTATAAGGAATAAGGCAGG - Intronic
952792077 3:37207805-37207827 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
953589381 3:44236867-44236889 CACTGAATAAGGAGAAAGGAGGG - Intergenic
953599174 3:44346854-44346876 CTGTGTGTAATGAAAAGGGTTGG + Intronic
953656304 3:44857508-44857530 CTGTGTGTAATGAAAAGGGTTGG + Intronic
953721440 3:45358802-45358824 TTTTGTATATGGTGAAAGGTAGG + Intergenic
953834229 3:46329332-46329354 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
953840905 3:46389598-46389620 CTGTGTGTAAGGAAAAAGGATGG + Intergenic
954161528 3:48726311-48726333 CTGTGTGTAATGAAAAGGGTTGG + Intronic
955265498 3:57439514-57439536 TTTTGTATATGGTGAAAGGTAGG - Intronic
955550809 3:60083134-60083156 TTTTGTATATGGTGAAAGGTAGG + Intronic
955616661 3:60815407-60815429 CTTTGTATATGGTGAAATGTAGG + Intronic
955635460 3:61023819-61023841 TTTTGTATAAGGAGTAAGGAAGG - Intronic
956000783 3:64727995-64728017 AAGTGTAAAAGGAGAAAGGTGGG - Intergenic
956030321 3:65030291-65030313 CTGTATATAGCCAGAAAGGTAGG + Intergenic
956985118 3:74689757-74689779 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
957067726 3:75539422-75539444 CTGTGTTTAAGGTGAGAAGTGGG - Intergenic
957451669 3:80388600-80388622 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
957697884 3:83666537-83666559 CTTTGTGTAAGCAGAAAGATAGG + Intergenic
957734689 3:84190160-84190182 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
957879313 3:86189589-86189611 TTTTGTATATGGTGAAAGGTGGG - Intergenic
957904599 3:86540209-86540231 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
958422194 3:93941632-93941654 CTGTGTGTAATGAAAAGGGTTGG - Intronic
958677783 3:97289251-97289273 TTTTGTATAAGGTGAAAGATAGG + Intronic
958751237 3:98194812-98194834 CTGTGTGTAATGAAAACGGTTGG - Intronic
959022154 3:101199338-101199360 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
959147518 3:102566885-102566907 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
959476307 3:106816275-106816297 CTGTATACCTGGAGAAAGGTAGG - Intergenic
959719819 3:109474012-109474034 TTTTGTATATGGTGAAAGGTAGG + Intergenic
959834184 3:110898972-110898994 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
959947652 3:112143904-112143926 TTTTGTATATGGTGAAAGGTAGG + Intronic
959988375 3:112602270-112602292 CTGAGAAGAAGGAGAAAGATTGG - Intergenic
960759644 3:121059143-121059165 CTTTGTATAAGGTGTAAGGAAGG + Intronic
961293720 3:125867312-125867334 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
961712516 3:128838538-128838560 CTGTGTGTAATGAAAAAGGTTGG + Intergenic
961747101 3:129071228-129071250 GGGTGAATAAGGAGGAAGGTAGG - Intergenic
961892357 3:130140869-130140891 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
962104782 3:132379324-132379346 CTGTGTCTATGGAGGAAGGTGGG + Intergenic
962234091 3:133693150-133693172 CTAGGGATAAGGAGGAAGGTGGG - Intergenic
962237950 3:133724826-133724848 CTTTGTATAAGGTGTAAGGAAGG + Intergenic
962287218 3:134096893-134096915 CTTTGTATAAGGTGTAAGGAAGG + Intronic
962660869 3:137599195-137599217 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
962713184 3:138104288-138104310 CTGTGTCTAAGGAGGAACATGGG + Intronic
962861741 3:139409555-139409577 CTGTGTATAAGGTGTAAGGAAGG - Intergenic
962911135 3:139850994-139851016 TTTTGTATACGGTGAAAGGTAGG + Intergenic
962942941 3:140142111-140142133 ATTTGTATAAGGAGACAAGTGGG + Intronic
963393302 3:144697569-144697591 TTTTGTATATGGTGAAAGGTAGG + Intergenic
963455836 3:145546109-145546131 CAGTGTATAATGTGAAATGTGGG + Intergenic
963505862 3:146183712-146183734 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
963521856 3:146365774-146365796 CTGTGTGTAATGAAAATGGTTGG - Intergenic
964300023 3:155277174-155277196 CTGTGTGTAATGAAAAAGGTTGG + Intergenic
964301001 3:155284808-155284830 CTGTGTGTAAGGAAAAAGGTTGG + Intergenic
964808596 3:160638572-160638594 TTATGAATAAGTAGAAAGGTGGG + Intergenic
964984632 3:162724381-162724403 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
965182940 3:165427726-165427748 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
965227392 3:166007203-166007225 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
965262420 3:166502773-166502795 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
965336567 3:167434936-167434958 CTGTGTGTAATGAAAACGGTTGG - Intergenic
965338307 3:167455425-167455447 CTGGGGATAAGGGGAAAGGAAGG - Intronic
965353804 3:167648772-167648794 TTGTGTAGAAGGCGGAAGGTGGG + Intronic
965497825 3:169419578-169419600 TTGTGTATAAGGTGTAAGGAAGG - Intronic
965624629 3:170674355-170674377 CTGTGTGTAATGAAAAGGGTTGG + Intronic
965629725 3:170720127-170720149 CTTTTTATATGGAGAGAGGTAGG - Intronic
965639778 3:170819788-170819810 CTGTGTGTAATGAAAAGGGTTGG + Intronic
965893964 3:173550945-173550967 ATGTGTATAGGGAGAAAAATCGG - Intronic
966067061 3:175831394-175831416 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
966085665 3:176065054-176065076 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
966304539 3:178515805-178515827 TTTTGTATATGGTGAAAGGTAGG - Intronic
966352249 3:179043543-179043565 TTTTGTATAAGGAGTAAGGAAGG - Intronic
966398202 3:179522914-179522936 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
966469202 3:180269783-180269805 TTTTGTATATGGTGAAAGGTAGG + Intergenic
966492649 3:180545494-180545516 TTTTGTATATGGTGAAAGGTAGG + Intergenic
966726177 3:183110809-183110831 TTTTGTGTATGGAGAAAGGTAGG + Intronic
967214397 3:187198307-187198329 CTGTGCAAAAGGAGAAAGCCAGG - Intronic
967286351 3:187874344-187874366 CTGCTTAAAAGGAGAAAGGGAGG + Intergenic
967398635 3:189035257-189035279 TTTTGTATATGGTGAAAGGTAGG - Intronic
967624422 3:191668478-191668500 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
968413013 4:405569-405591 CTGTGTGTAATGAAAAATGTTGG + Intergenic
968466181 4:752568-752590 TTGTGGATAAGGAGTGAGGTGGG + Intronic
968695410 4:2023155-2023177 TTTTGTATAAGGTGAAAGGTAGG - Intronic
969653822 4:8484611-8484633 CTGTGTGTAATGAAAAGGGTTGG + Intronic
969750419 4:9106273-9106295 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
969782471 4:9419291-9419313 TTTTGTATATGGTGAAAGGTAGG - Intergenic
969801157 4:9566618-9566640 CTGTGTTTAAGGTGAGAAGTGGG + Intergenic
970028993 4:11655735-11655757 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
970087778 4:12367484-12367506 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
970175459 4:13334997-13335019 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
970357178 4:15267450-15267472 TTTTGTATATGGTGAAAGGTAGG + Intergenic
970815058 4:20145353-20145375 TTTTGTATAAGGTGAAAGGAAGG - Intergenic
970956362 4:21816564-21816586 CTGTGTACTGGGAGAAAGGGAGG - Intronic
971260064 4:25048354-25048376 TTTTGTATATGGTGAAAGGTAGG + Intergenic
971526225 4:27621828-27621850 TTTTGTATATGGTGAAAGGTGGG - Intergenic
971908313 4:32758690-32758712 TTTTGTATAAGGTGAAAGATAGG - Intergenic
972372005 4:38433365-38433387 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
972739291 4:41875212-41875234 CTGAGCATCAGGAGAAAGGTGGG + Intergenic
973047027 4:45547235-45547257 TTATGTATATGGTGAAAGGTAGG - Intergenic
973273461 4:48284869-48284891 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
973751309 4:54023151-54023173 CTGTGTGTAATGAAAAGGGTTGG - Intronic
974543287 4:63267135-63267157 TTTTGTATAAGGAGGAAGGAAGG - Intergenic
974548123 4:63338539-63338561 CTTTGTATAAGGTGTAAGGAAGG - Intergenic
974649853 4:64741229-64741251 TTTTGTATAAGGTGAAAGGAAGG - Intergenic
974738993 4:65980070-65980092 TTTTGTATATGGTGAAAGGTAGG + Intergenic
974925996 4:68298146-68298168 TTTTGTATATGGTGAAAGGTAGG + Intergenic
975001457 4:69227595-69227617 ATCTTTATAAGGAGAAAGGTAGG - Intergenic
975003985 4:69264483-69264505 ATGTTTATAAGGAGAAAGGTAGG + Intergenic
975012345 4:69373080-69373102 ATCTTTATAAGGAGAAAGGTAGG + Intronic
975225753 4:71870101-71870123 CTGGGTATAGGGAGAAGGCTTGG + Intergenic
975515665 4:75245029-75245051 TTTTGTATAAGGTGAAAGGAAGG - Intergenic
976719367 4:88155031-88155053 CTGTGTGTAATGAAAAGGGTTGG + Intronic
976804702 4:89033900-89033922 TTTTGTATATGGTGAAAGGTAGG - Intronic
977002593 4:91522051-91522073 TTTTGTATAAGGTGAAAGGAAGG + Intronic
977180084 4:93863431-93863453 TTTTGTATAAGGTGAGAGGTGGG - Intergenic
978006040 4:103618247-103618269 TTTTGTATATGGTGAAAGGTAGG + Intronic
978257630 4:106711554-106711576 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
978722552 4:111928687-111928709 TTTTGTATATGGTGAAAGGTAGG + Intergenic
979219221 4:118201956-118201978 TTTTGTATATGGTGAAAGGTAGG + Intronic
979501890 4:121449888-121449910 GTGTGTATGTGGAGAAGGGTTGG + Intergenic
980285173 4:130771081-130771103 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
981096127 4:140783845-140783867 CTTTGTATAAGGTGTAAGGAAGG + Intergenic
981747051 4:148062133-148062155 TTGTGTATAGGGAGACAAGTGGG + Intronic
982181198 4:152749982-152750004 CTTTGTATAAGGTGTAAGGAAGG - Intronic
982315979 4:154032569-154032591 TTTTGTATATGGTGAAAGGTAGG + Intergenic
982319071 4:154060156-154060178 TTGTGTGTAATGAAAAAGGTTGG - Intergenic
982347946 4:154382250-154382272 TTTTGTATATGGTGAAAGGTGGG - Intronic
982413970 4:155110474-155110496 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
982418386 4:155164043-155164065 CTGTGTAGAAGAAGAAACCTTGG - Intergenic
982842984 4:160216119-160216141 TTTTGTATATGGTGAAAGGTAGG + Intergenic
983345788 4:166524243-166524265 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
983368781 4:166832253-166832275 TTTTGTATATGGTGAAAGGTAGG + Intronic
983707899 4:170681205-170681227 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
984098814 4:175463389-175463411 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
984171401 4:176363735-176363757 CTGTATATATGGTGAAAGGCAGG + Intergenic
984212104 4:176862419-176862441 TTTTGTATACGGAGTAAGGTAGG - Intergenic
985078773 4:186244107-186244129 CTGTGTGTAATGAAAAGGGTTGG + Intronic
985435942 4:189929572-189929594 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
986368721 5:7060140-7060162 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
986375454 5:7126448-7126470 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
987558627 5:19488477-19488499 ATGTGTATGAAGAGAAAGCTAGG + Intronic
987893679 5:23917113-23917135 TTTTGTATAAGGTGCAAGGTAGG + Intergenic
988677915 5:33452805-33452827 CTTTGTAGAAAGAGAAAGGTGGG + Intronic
988746670 5:34146637-34146659 CTTTGTATACGGTGAAAGTTAGG - Intergenic
988975618 5:36512999-36513021 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
989032400 5:37132943-37132965 TTTTGTATATGGTGAAAGGTAGG + Intronic
989305853 5:39954972-39954994 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
989545900 5:42672625-42672647 TTTTGTATATGGTGAAAGGTAGG - Intronic
989688670 5:44116558-44116580 CTGTGTATAATGAAAAGGGTTGG + Intergenic
989969074 5:50499545-50499567 CTTTGTATAAGGTGTAAGGAAGG - Intergenic
990564937 5:57019354-57019376 CTGTGTGTAATGAAAAAAGTTGG + Intergenic
990930365 5:61083312-61083334 TTTTGTATACGGCGAAAGGTAGG + Intronic
991384861 5:66075163-66075185 CTGTGTATATGGAGGCTGGTGGG - Exonic
991625735 5:68599094-68599116 ATGTGTCTAAGGGAAAAGGTAGG + Intergenic
992028959 5:72701547-72701569 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
992032165 5:72732558-72732580 TTTTGTATAAGGTGTAAGGTAGG - Intergenic
992785933 5:80170676-80170698 CTGTGTTTATGGAGAAAACTTGG - Intronic
992922539 5:81541741-81541763 TTTTGTATATGGTGAAAGGTAGG - Intronic
992961065 5:81957001-81957023 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
994207389 5:97050640-97050662 CTGTATTTAAGGAGGAAGCTGGG + Intergenic
994325140 5:98438443-98438465 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
994342132 5:98642746-98642768 CTGTTTGTAAGGAAAAAGATTGG - Intergenic
994375544 5:99013314-99013336 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
994508400 5:100671836-100671858 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
994643895 5:102445740-102445762 TTTTGTATATGGTGAAAGGTAGG + Intronic
995387887 5:111608471-111608493 TTTTGTATATGGTGAAAGGTAGG + Intergenic
995673029 5:114628737-114628759 TTTTGTATAAGGTGAAAGTTAGG - Intergenic
995689937 5:114814341-114814363 CTTTGTATAAGGTGTAAGGAAGG + Intergenic
995769574 5:115653885-115653907 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
995782962 5:115797358-115797380 CCGTGTAACAGGAGACAGGTGGG - Intergenic
996052381 5:118948722-118948744 CTGTGTGTAATGAAAAGGGTTGG + Intronic
996489090 5:124071392-124071414 CTATCTCTAAGGAGAAAGGCAGG - Intergenic
996697222 5:126411273-126411295 TTGTGTATATGGTGAAAGGCAGG + Intronic
996725678 5:126671948-126671970 CTGTGTGTAATGAAAAAGGTTGG + Intergenic
996745204 5:126841546-126841568 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
996917864 5:128732851-128732873 CTGTGTGTAATGAAAAAGGTTGG - Intronic
998633432 5:143926257-143926279 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1000012681 5:157247376-157247398 GTGTGTATAACTAGGAAGGTTGG + Intronic
1000424625 5:161076182-161076204 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1000584344 5:163078171-163078193 TTTTGTATAAGGTGAAAGGAAGG - Intergenic
1000668973 5:164036371-164036393 TTGTGTGTAAGAAGAAAGCTAGG + Intergenic
1001839260 5:174860013-174860035 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1003099999 6:3169747-3169769 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1003123613 6:3337925-3337947 CTGCCTCTAAGCAGAAAGGTGGG - Intronic
1003626099 6:7742868-7742890 TTATGTATAATGAGACAGGTAGG + Intronic
1003822884 6:9919771-9919793 CTGAGTAGAGGGAGAAAGATAGG - Intronic
1004142218 6:13028793-13028815 CACTGAATAAGGAGCAAGGTGGG + Intronic
1004730628 6:18354954-18354976 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1004837235 6:19542621-19542643 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1005544807 6:26854875-26854897 CTTTGTATACGGTGAAAGTTAGG - Intergenic
1005786306 6:29249049-29249071 CTGTGTGTAAGGAAAAGGGATGG + Intergenic
1006198676 6:32265719-32265741 CTTTGTATAAGGTGTAAGGAAGG - Intergenic
1006277073 6:33013651-33013673 ATGTGTGTAAAGAGAAAGGAGGG + Intergenic
1006325031 6:33347165-33347187 CTGTGTGTAATGAAAAGGGTCGG - Intergenic
1006337249 6:33427309-33427331 CTCAGGATAAGGAGAAAGATGGG - Intronic
1006358205 6:33573037-33573059 GTGTCTATAAGGAGAGAGGAAGG + Exonic
1007084501 6:39133949-39133971 CTGTGTGTAATGGAAAAGGTTGG + Intergenic
1007869501 6:45017516-45017538 TTTTGTATAAGGAGTAAGGAAGG + Intronic
1007874758 6:45083963-45083985 TTCTGTATATGGTGAAAGGTAGG - Intronic
1007948526 6:45848291-45848313 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
1008324872 6:50166080-50166102 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1008588820 6:52973020-52973042 CTGAGTATAAGTAGAAAATTGGG + Intergenic
1008771625 6:54985772-54985794 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1009015597 6:57896509-57896531 CTTTGTATACGGTGAAAGTTCGG - Intergenic
1009577761 6:65488947-65488969 TTTTGTATAAGGAGTAAGGAAGG - Intronic
1010143073 6:72633855-72633877 TTTTGTATATGGTGAAAGGTAGG - Intronic
1010784707 6:79986630-79986652 TTGTTTCTAAGGAGAAAGGCAGG - Intergenic
1010789553 6:80049256-80049278 CTTTGTATAAGGTGTAAGGAAGG + Intergenic
1011238759 6:85247829-85247851 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1011322397 6:86110475-86110497 CTTTGTATATGGTGAGAGGTAGG + Intergenic
1011365251 6:86574531-86574553 TTTTGTATAAGGTGAAAGGAAGG - Intergenic
1011393647 6:86882103-86882125 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
1012253159 6:97002148-97002170 CTGAGTATAAGTCCAAAGGTAGG + Intronic
1012560026 6:100569150-100569172 TTTTGTATATGGTGAAAGGTAGG + Intronic
1013797910 6:113906489-113906511 CTGTCTAGAAGGAGGCAGGTGGG + Intergenic
1013930167 6:115521063-115521085 TTTTGTATAAGGTGAAAGGAAGG - Intergenic
1014059550 6:117054843-117054865 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1014580454 6:123130214-123130236 CTGTGTTTTAGGGGAAAGGATGG + Intergenic
1014700607 6:124683077-124683099 ATGTGTTTGAGGACAAAGGTGGG - Intronic
1014819323 6:125969175-125969197 ATTTGTATATGGTGAAAGGTAGG + Intronic
1014862955 6:126493010-126493032 TTTTGTATAGGGTGAAAGGTGGG + Intergenic
1014952772 6:127577634-127577656 TTGTGGATAAGGAGAAGGATAGG - Intronic
1015109359 6:129573933-129573955 TTTTGTATAAGGTGTAAGGTAGG - Intergenic
1015165437 6:130196037-130196059 CTGTGTGTAATGAAAAGGGTTGG - Intronic
1015349865 6:132205282-132205304 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1015358626 6:132309823-132309845 TTGTGTATAAGGTGTAAGGAAGG - Intronic
1015476409 6:133663475-133663497 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1016061024 6:139630377-139630399 TTTTGTATATGGAGAGAGGTAGG + Intergenic
1016192134 6:141282539-141282561 CTGTGTAAAAGGAGATGGGATGG - Intergenic
1016204760 6:141456531-141456553 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1016249095 6:142019525-142019547 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1016277832 6:142375407-142375429 CTGTGTTTCAGGAGAAATGATGG + Intronic
1016664252 6:146616599-146616621 CTTTGCATATGGTGAAAGGTGGG + Intronic
1017032021 6:150232593-150232615 CTTTGTATATGGTGTAAGGTAGG + Intronic
1017215682 6:151903265-151903287 CTGTGTCTAATCAGAAAGTTAGG + Intronic
1017277903 6:152591480-152591502 TTTTGTATATGGTGAAAGGTAGG - Intronic
1017352108 6:153454586-153454608 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1017355353 6:153499443-153499465 ATTTGTATATGGTGAAAGGTAGG - Intergenic
1017580739 6:155862115-155862137 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1018113629 6:160561237-160561259 TTGTGTATAAGGTGTAAGGAAGG + Intronic
1018135949 6:160778598-160778620 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1018653435 6:166010085-166010107 CACTGTAGAAGGAGAATGGTGGG + Intergenic
1018950859 6:168378020-168378042 CTGTGGAGAAGGAGAAACGGGGG - Intergenic
1018959345 6:168436210-168436232 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1019227008 6:170521306-170521328 TTTTGTATACGGTGAAAGGTAGG - Intergenic
1019261240 7:83159-83181 ATGTGTACAAGAAGAAAGGAAGG - Intergenic
1020322563 7:6950365-6950387 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1020540907 7:9460542-9460564 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1020843707 7:13255845-13255867 CTGGGGTTAAGGAGTAAGGTGGG + Intergenic
1021074599 7:16286790-16286812 CTGAGTAGAAGGAGAATGCTGGG - Intronic
1021146100 7:17090497-17090519 CTATGTATAGGCAGAAAGATAGG + Intergenic
1021466402 7:20949106-20949128 TTTTGTATAAGGTGAAAGATAGG - Intergenic
1021637580 7:22707124-22707146 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1021638455 7:22714506-22714528 CTGTGTAAAAGAGAAAAGGTAGG + Intergenic
1021660814 7:22916457-22916479 CTGCGTGTAATGAAAAAGGTTGG - Intergenic
1022421062 7:30223853-30223875 ATGTGTAGAATGAGAAAGGCAGG + Intergenic
1022587161 7:31624592-31624614 CTTTGTATAAGGTGTAAGGAAGG - Intronic
1023124546 7:36942477-36942499 CTCTGTCTCAGGAGACAGGTGGG + Intronic
1024199590 7:47092017-47092039 TTTTGTATATGGAGAGAGGTGGG - Intergenic
1025183693 7:56839580-56839602 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1025688232 7:63737407-63737429 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1027158573 7:75785807-75785829 CTGTGTGTAATGAAAAGGGTTGG - Intronic
1027910289 7:84241798-84241820 TTTTGTATAAGGTGTAAGGTAGG + Intronic
1028139612 7:87258997-87259019 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1028181132 7:87726262-87726284 TTGTGTATAAGGTGTAAGGAAGG + Intronic
1028301994 7:89211535-89211557 TTTTGTATAAGGTGAAAGGAAGG + Intronic
1028589644 7:92481611-92481633 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1028785292 7:94785759-94785781 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1029631982 7:101758060-101758082 CTGTGGATAAGTGGAAACGTGGG - Intergenic
1030193750 7:106833512-106833534 CCGTGTGTAAGGAAAAAGGATGG - Intergenic
1030268698 7:107647499-107647521 CTTTGTATAAGGTGTAAGGAAGG + Intergenic
1031206814 7:118769474-118769496 CTGTGTACAAGGCTAAAGGCTGG - Intergenic
1031246398 7:119318103-119318125 TTGTGTATAAGGTGTAAGGCAGG - Intergenic
1031422215 7:121565816-121565838 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1031577281 7:123429985-123430007 CTTTGTATAAGGTGTAAGGAAGG - Intergenic
1031664113 7:124463896-124463918 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1031666887 7:124495675-124495697 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1031704374 7:124962628-124962650 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1031777567 7:125921289-125921311 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1031780466 7:125955459-125955481 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1031818603 7:126471361-126471383 TTGTGTATAAGGTGTAAGGAAGG + Intronic
1031899978 7:127397992-127398014 TTGTGTATAAGGTGTAAGGAAGG + Intronic
1031905479 7:127455910-127455932 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1031908698 7:127490210-127490232 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1032939350 7:136770406-136770428 CTTTGTATAAGGTGTAAGGAAGG - Intergenic
1033084902 7:138332372-138332394 CTGTGTGTAATGAAAAAGTTTGG - Intergenic
1033088784 7:138366241-138366263 TTGTGTGTAATGAAAAAGGTTGG - Intergenic
1033211705 7:139464633-139464655 CTGTGTATAATGAAAAAGGTTGG - Intronic
1033625762 7:143108165-143108187 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1033870035 7:145741937-145741959 CAGTGAATAATGAGAATGGTTGG + Intergenic
1034061612 7:148096911-148096933 CTGAGTCTGAGGAGAAGGGTTGG + Intronic
1034278571 7:149835926-149835948 CTGTTTAGAAGCAGAAAGTTGGG - Intergenic
1034934887 7:155192566-155192588 CTGTGTGAGAGGAGAAAGGAAGG + Intergenic
1035103757 7:156423768-156423790 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1035162260 7:156959785-156959807 GTGTGTTGAAGGAGAAAGGAAGG + Intronic
1035880439 8:3240210-3240232 CTGTGGGTAATGAAAAAGGTTGG + Intronic
1036070694 8:5438632-5438654 CTGTGGGTAATGAAAAAGGTTGG + Intergenic
1036253816 8:7188078-7188100 CTGTGTTTAAGGTGAGAAGTTGG - Intergenic
1036363678 8:8099402-8099424 CTGTGTTTAAGGTGAGAAGTGGG + Intergenic
1036858435 8:12321408-12321430 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1036877424 8:12485036-12485058 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1037936071 8:22915850-22915872 CTGTGTATACAGAGAAGGGTTGG + Intronic
1037966802 8:23140993-23141015 TTGTGTATATGGTGAAAAGTAGG - Intronic
1038437445 8:27545829-27545851 CTGTGTATAGGGAGAAAGCCAGG + Intergenic
1038477786 8:27880168-27880190 TTTTGTATAAGGTGAAAGGTAGG - Intronic
1038902734 8:31862237-31862259 GTGTGTATCAGGAGAAAAGTTGG + Intronic
1039167656 8:34702972-34702994 TTTTGTATAAGAAGAAACGTAGG + Intergenic
1039335555 8:36585426-36585448 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1040428419 8:47312892-47312914 TTGTGTATAAGGTGTAAGGAAGG + Intronic
1040458734 8:47626208-47626230 TTGTGTATAAGGTGTAAGGAAGG - Intronic
1040686236 8:49876287-49876309 CTTTGTATAAGGTGTAAGGAAGG + Intergenic
1040993164 8:53373959-53373981 TTTTGTATAAGGTGTAAGGTAGG - Intergenic
1041041398 8:53849881-53849903 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1041129534 8:54682969-54682991 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1041651612 8:60308488-60308510 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1041665013 8:60435047-60435069 TTTTGTATAAGGTGAGAGGTAGG + Intergenic
1041728478 8:61041003-61041025 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1042706314 8:71668031-71668053 CTGTGTGTAATGAAAAAGGTTGG - Intergenic
1043189092 8:77194403-77194425 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1043799739 8:84593119-84593141 CTTTGTATATGGTGTAAGGTAGG + Intronic
1044140544 8:88646301-88646323 TTTTGTATAAGGTGAAAGGAAGG + Intergenic
1044144365 8:88693082-88693104 TTTTGTATAAGGTGAAAGGAAGG + Intergenic
1044179145 8:89167037-89167059 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1044233314 8:89803850-89803872 CTTTGTATAAGGTGTAAGGAAGG - Intergenic
1044255022 8:90049997-90050019 TTTTGTATAAGGAGTAAGGAAGG - Intronic
1044283222 8:90380388-90380410 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1044552498 8:93527761-93527783 CTATGTATAAGGTGAGAGATGGG + Intergenic
1044597086 8:93970020-93970042 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1045802565 8:106118251-106118273 TTTTGTATAAGGAGTAAGGATGG - Intergenic
1045909117 8:107384790-107384812 TTTTGTATAAGGTGAAAGGTGGG + Intronic
1045967744 8:108044899-108044921 TTTTGTATACGGTGAAAGGTAGG - Intronic
1046075093 8:109304142-109304164 CTGTGTGTAATGAAAAAGGTTGG - Intronic
1046821640 8:118639992-118640014 CTGTGCCTAAGGAGCAGGGTAGG - Intergenic
1046975759 8:120275311-120275333 TTTTGTATAAGGTGAGAGGTAGG - Intronic
1047181462 8:122592805-122592827 CTGCGTATAAGGAAAGGGGTGGG - Intergenic
1047492007 8:125382819-125382841 CTGTTGATAAGCAGAAAGGGTGG + Intergenic
1047909955 8:129517245-129517267 CTGTCTATCAGGATCAAGGTTGG - Intergenic
1048124632 8:131620020-131620042 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1048135689 8:131744439-131744461 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1048415291 8:134221470-134221492 TTTTGTATACGGTGAAAGGTAGG - Intergenic
1048728192 8:137410271-137410293 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1048756104 8:137739897-137739919 CTTTGTATAAGGTGTAAGGAAGG + Intergenic
1048764012 8:137826814-137826836 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1049868568 8:144956090-144956112 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1049966137 9:781848-781870 TTTTGTATAAGGTGAGAGGTAGG - Intergenic
1050140738 9:2513323-2513345 CTGTGTGTAAGGAAAAAGTTTGG - Intergenic
1050390582 9:5139373-5139395 CTTTGTAGAAGGAGCAATGTAGG + Intronic
1051102467 9:13536719-13536741 CTTTGTATAAGGATAAATGAGGG - Intergenic
1052082579 9:24225820-24225842 TTTTGTATAAGGTGAAAGGAAGG + Intergenic
1052231253 9:26156505-26156527 CTATGTATAAGGTGCTAGGTTGG - Intergenic
1052661551 9:31439408-31439430 CTGTCTATAAGGAGAAAAGTGGG - Intergenic
1052707883 9:32015372-32015394 CTTTGTATATGGTGAAAGGTAGG + Intergenic
1052792933 9:32893816-32893838 TTTTGTATAAGGTGAAAGGTAGG - Intergenic
1053118033 9:35522592-35522614 CTGTGTATAAGGAGCTATGCTGG - Intronic
1053322221 9:37109255-37109277 CTTTGTATATGGAGTGAGGTAGG - Intergenic
1053531419 9:38885725-38885747 CTGTCTATAATCAGAATGGTAGG - Intergenic
1053715049 9:40878739-40878761 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1053751330 9:41259280-41259302 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1053787875 9:41665160-41665182 CTGGGTTTAAGGTGAGAGGTTGG - Intergenic
1053798629 9:41748769-41748791 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1054146574 9:61566192-61566214 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1054157254 9:61649607-61649629 CTGGGTTTAAGGTGAGAGGTTGG + Intergenic
1054176151 9:61876502-61876524 CTGGGTTTAAGGTGAGAGGTTGG - Intergenic
1054187044 9:61960814-61960836 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1054203643 9:62110154-62110176 CTGTCTATAATCAGAATGGTAGG - Intergenic
1054256852 9:62823609-62823631 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1054284590 9:63156256-63156278 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1054318786 9:63631138-63631160 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1054334454 9:63792004-63792026 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1054334773 9:63796340-63796362 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1054390226 9:64608698-64608720 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1054466308 9:65497261-65497283 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1054634719 9:67478210-67478232 CTGTCTATAATCAGAATGGTAGG + Intergenic
1054651464 9:67627708-67627730 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1054661388 9:67704306-67704328 CTGGGTTTAAGGTGAGAGGTTGG + Intergenic
1054736205 9:68753048-68753070 TTTTGTATAAGGTGAGAGGTAGG + Intronic
1054807251 9:69406745-69406767 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1054828153 9:69594130-69594152 CTGTTTACAAGGGGAAAAGTTGG - Intronic
1055415515 9:76078447-76078469 TTTTGTATATGGTGAAAGGTAGG + Intronic
1055626959 9:78184527-78184549 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1056229771 9:84531309-84531331 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1056238994 9:84624682-84624704 CTGTGTATTTGGAGGAAGGAGGG - Intergenic
1056571734 9:87822783-87822805 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1056942505 9:90967400-90967422 ATGTGTAAAAGGAGAAAGGGAGG - Intergenic
1057358603 9:94352752-94352774 CTGTGTATAAGGTGAAATTTAGG - Intergenic
1057649148 9:96904858-96904880 CTGTGTATAAGGTGAAATTTAGG + Intronic
1057965965 9:99503572-99503594 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1058102629 9:100934261-100934283 TTTTGTATATGGTGAAAGGTGGG + Intergenic
1058172657 9:101701494-101701516 TTTTGTATATGGTGAAAGGTAGG - Intronic
1058226753 9:102373365-102373387 ATGTCAATAGGGAGAAAGGTTGG + Intergenic
1058588794 9:106538939-106538961 CTTTGTATAAGGTGTAAGGAAGG + Intergenic
1058612629 9:106792061-106792083 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1058781662 9:108342897-108342919 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1059522207 9:114953791-114953813 GTATGTATAAGGAGCAAAGTAGG + Intergenic
1059863258 9:118487665-118487687 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1060020123 9:120122678-120122700 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
1060737641 9:126076619-126076641 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1060868754 9:127022254-127022276 CTGTGTGTGTGGAGAAAGGGAGG - Intronic
1061733630 9:132636788-132636810 CAGTGAATAAGGAGAAAGAAAGG + Intronic
1185593376 X:1293168-1293190 CTGTGTCTATGTAGAAAGGAAGG - Intronic
1186057698 X:5667492-5667514 CTTTGTAGCAGGAGAAAGGAGGG - Intergenic
1186061633 X:5714461-5714483 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1186242868 X:7588764-7588786 TTTTGTATAAGGTGAAAGGAAGG + Intergenic
1186259055 X:7756404-7756426 TTTTGTATAAGGTGAAAGGAAGG - Intergenic
1186333090 X:8557144-8557166 TTTTGTATAAGGTGAAAGGAAGG - Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187103576 X:16219187-16219209 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1187180764 X:16941649-16941671 CTGAGTACAACCAGAAAGGTAGG + Intergenic
1187302919 X:18068700-18068722 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1187459091 X:19469370-19469392 TTGTGTATAAGGTGTAAGGAAGG - Intronic
1187848054 X:23561822-23561844 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1187867185 X:23734061-23734083 CTGCGTATAAGAAGATAGGTGGG - Intronic
1188035208 X:25309961-25309983 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1188148080 X:26638855-26638877 CTGTATATGAGCAGAGAGGTGGG - Intergenic
1188300844 X:28504546-28504568 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1188431260 X:30107061-30107083 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1188463156 X:30451110-30451132 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1188631943 X:32374474-32374496 TTTTGTATATGGTGAAAGGTAGG + Intronic
1188848729 X:35105802-35105824 TTTTGTATAAGGTGTAAGGTAGG - Intergenic
1188892615 X:35629452-35629474 TTTTGTATAAGGTGAAAGGAAGG + Intergenic
1189064926 X:37797131-37797153 CTGTGAAAAAGGGGAAGGGTGGG + Intronic
1189758441 X:44296212-44296234 ATGTGGAAAAGGAGAAAGCTGGG + Intronic
1189766316 X:44375866-44375888 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1189861560 X:45277175-45277197 TTGTGTATATGGTGAAAGGTAGG + Intergenic
1190422281 X:50297300-50297322 TTTTGTATAAGGTGAAAGGAAGG + Intronic
1190450114 X:50571015-50571037 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1190531517 X:51383229-51383251 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1190605022 X:52132360-52132382 TTTTGTATATGGTGAAAGGTTGG - Intergenic
1190715666 X:53101098-53101120 TTGTGGATATGGAGAAAGTTTGG - Intergenic
1191014003 X:55790694-55790716 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1191210469 X:57879444-57879466 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1191761540 X:64652782-64652804 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1191824611 X:65351292-65351314 CTTTGTATAAGGTGTAAGGAAGG - Intergenic
1191825808 X:65363615-65363637 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1191891010 X:65940877-65940899 CTGTGCATGTGGAGAAAGGGAGG + Intergenic
1192666463 X:73092972-73092994 TTGTGTATAAGGTGAGAGATAGG + Intergenic
1192678190 X:73222381-73222403 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
1192764231 X:74125970-74125992 CTGGGTATAAGGTGAGAGGATGG + Intergenic
1193004837 X:76604578-76604600 ATTTGTAAAAGGAGAAATGTCGG - Intergenic
1193032519 X:76914459-76914481 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1193056043 X:77152266-77152288 TTTTGTATAAGGTGAAAGGAAGG - Intergenic
1193438375 X:81508762-81508784 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1193537313 X:82730555-82730577 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1193567509 X:83096442-83096464 CTTTGTATAAGGTGTAAGGAAGG - Intergenic
1193795039 X:85863799-85863821 CTTTATATATGGAGAAACGTAGG + Exonic
1193875319 X:86855510-86855532 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1194012477 X:88579812-88579834 TTTTGTATATGGAGAAAGGTAGG - Intergenic
1194126595 X:90025730-90025752 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1194201099 X:90953471-90953493 TTTTGTATAAGGTGAAAGATAGG + Intergenic
1194228739 X:91295663-91295685 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1194242401 X:91468359-91468381 CTTTGTATATGGTGAAAGGAAGG + Intergenic
1194376774 X:93145224-93145246 CTGGCTCTAAGCAGAAAGGTAGG + Intergenic
1194660914 X:96627747-96627769 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1194918482 X:99734049-99734071 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1195006512 X:100690675-100690697 CTGGGTAGAAGGGGAAGGGTAGG - Intronic
1195489924 X:105455491-105455513 ATTTGTATATGGTGAAAGGTAGG + Intronic
1195528257 X:105920064-105920086 TTTTGTATAAGGTGAAAGGAAGG + Intronic
1195575490 X:106445198-106445220 TTTTGTATATGGTGAAAGGTAGG + Intergenic
1195576263 X:106454696-106454718 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1195671136 X:107471023-107471045 CAGGGAATAAGGAGAAAGCTAGG + Intergenic
1196219795 X:113099634-113099656 TTTTGTATACGGTGAAAGGTAGG + Intergenic
1196281863 X:113831658-113831680 ATGTATATCAGGAGAAAGGTGGG - Intergenic
1196300231 X:114043700-114043722 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1196992444 X:121344992-121345014 CTGTGTGTAATGAAAAGGGTTGG + Intergenic
1197319610 X:125011153-125011175 CTTTGTATAAGGGGTAAGGAAGG - Intergenic
1197499942 X:127230308-127230330 CTGTGGATAATGAAAAGGGTTGG - Intergenic
1197680321 X:129375848-129375870 TTTTGTATAAGGTGAAAGGAAGG - Intergenic
1197801355 X:130353082-130353104 TTTTGTATATGGTGAAAGGTAGG + Intronic
1198337726 X:135683605-135683627 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1198577960 X:138031385-138031407 ATTTGTATATGGTGAAAGGTAGG - Intergenic
1199026934 X:142950648-142950670 TTGTGTGTAAGGTGAAAGGAAGG + Intergenic
1199282021 X:146012979-146013001 TTTTGTATATGGTGAAAGGTTGG - Intergenic
1199354465 X:146845340-146845362 TTTTGTATATGGTGAAAGGTAGG - Intergenic
1199554187 X:149088768-149088790 TTTTGTATAAGGTGAAAGGAAGG - Intergenic
1199577599 X:149328401-149328423 CTGAGTAGAAGGAGAGAGATGGG - Intergenic
1200007548 X:153097831-153097853 CTGTGTGTAAGGAAAAAGGATGG + Intergenic
1200546944 Y:4528930-4528952 TTTTGTATAAGGTGAAAGATAGG + Intergenic
1200863439 Y:8017252-8017274 TTTTGTATAAGGTGAAAGGAAGG - Intergenic
1201333040 Y:12848628-12848650 CTTTGTATAAGGTGTAAGGAAGG + Intronic
1201405701 Y:13647627-13647649 TTTTGTATAAGGTGAAAGGAAGG + Intergenic
1201529105 Y:14972317-14972339 TTTTGTATAAGGTGAAAGGAAGG + Intergenic
1201937377 Y:19422850-19422872 CTGTGTGTAATGAAAAGGGTTGG - Intergenic
1202335424 Y:23804175-23804197 CTTTGCATAAGGTGAAAGGATGG - Intergenic
1202535343 Y:25865884-25865906 CTTTGCATAAGGTGAAAGGATGG + Intergenic