ID: 948646208

View in Genome Browser
Species Human (GRCh38)
Location 2:239406692-239406714
Sequence AGGGCGCATCTGCGGGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948646200_948646208 2 Left 948646200 2:239406667-239406689 CCACAGGCCAAGGGGAGGAGACA No data
Right 948646208 2:239406692-239406714 AGGGCGCATCTGCGGGGCCCAGG No data
948646203_948646208 -5 Left 948646203 2:239406674-239406696 CCAAGGGGAGGAGACACCAGGGC No data
Right 948646208 2:239406692-239406714 AGGGCGCATCTGCGGGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948646208 Original CRISPR AGGGCGCATCTGCGGGGCCC AGG Intergenic
No off target data available for this crispr