ID: 948647060

View in Genome Browser
Species Human (GRCh38)
Location 2:239411963-239411985
Sequence AGGGGTTGTGATTTTCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948647060_948647070 30 Left 948647060 2:239411963-239411985 CCACAAGGAAAATCACAACCCCT No data
Right 948647070 2:239412016-239412038 AGCCACCAGTCCAGCGATGGAGG No data
948647060_948647069 27 Left 948647060 2:239411963-239411985 CCACAAGGAAAATCACAACCCCT No data
Right 948647069 2:239412013-239412035 CTCAGCCACCAGTCCAGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948647060 Original CRISPR AGGGGTTGTGATTTTCCTTG TGG (reversed) Intergenic
No off target data available for this crispr