ID: 948647063

View in Genome Browser
Species Human (GRCh38)
Location 2:239411982-239412004
Sequence CAGGTCTGGCCATTGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948647063_948647070 11 Left 948647063 2:239411982-239412004 CCCTCACCCAATGGCCAGACCTG No data
Right 948647070 2:239412016-239412038 AGCCACCAGTCCAGCGATGGAGG No data
948647063_948647069 8 Left 948647063 2:239411982-239412004 CCCTCACCCAATGGCCAGACCTG No data
Right 948647069 2:239412013-239412035 CTCAGCCACCAGTCCAGCGATGG No data
948647063_948647073 19 Left 948647063 2:239411982-239412004 CCCTCACCCAATGGCCAGACCTG No data
Right 948647073 2:239412024-239412046 GTCCAGCGATGGAGGTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948647063 Original CRISPR CAGGTCTGGCCATTGGGTGA GGG (reversed) Intergenic
No off target data available for this crispr