ID: 948647064

View in Genome Browser
Species Human (GRCh38)
Location 2:239411983-239412005
Sequence TCAGGTCTGGCCATTGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948647064_948647069 7 Left 948647064 2:239411983-239412005 CCTCACCCAATGGCCAGACCTGA No data
Right 948647069 2:239412013-239412035 CTCAGCCACCAGTCCAGCGATGG No data
948647064_948647070 10 Left 948647064 2:239411983-239412005 CCTCACCCAATGGCCAGACCTGA No data
Right 948647070 2:239412016-239412038 AGCCACCAGTCCAGCGATGGAGG No data
948647064_948647073 18 Left 948647064 2:239411983-239412005 CCTCACCCAATGGCCAGACCTGA No data
Right 948647073 2:239412024-239412046 GTCCAGCGATGGAGGTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948647064 Original CRISPR TCAGGTCTGGCCATTGGGTG AGG (reversed) Intergenic