ID: 948647066

View in Genome Browser
Species Human (GRCh38)
Location 2:239411989-239412011
Sequence ACTGACTCAGGTCTGGCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948647066_948647069 1 Left 948647066 2:239411989-239412011 CCAATGGCCAGACCTGAGTCAGT No data
Right 948647069 2:239412013-239412035 CTCAGCCACCAGTCCAGCGATGG No data
948647066_948647070 4 Left 948647066 2:239411989-239412011 CCAATGGCCAGACCTGAGTCAGT No data
Right 948647070 2:239412016-239412038 AGCCACCAGTCCAGCGATGGAGG No data
948647066_948647073 12 Left 948647066 2:239411989-239412011 CCAATGGCCAGACCTGAGTCAGT No data
Right 948647073 2:239412024-239412046 GTCCAGCGATGGAGGTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948647066 Original CRISPR ACTGACTCAGGTCTGGCCAT TGG (reversed) Intergenic
No off target data available for this crispr