ID: 948647067

View in Genome Browser
Species Human (GRCh38)
Location 2:239411996-239412018
Sequence GCTGAGAACTGACTCAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948647067_948647073 5 Left 948647067 2:239411996-239412018 CCAGACCTGAGTCAGTTCTCAGC No data
Right 948647073 2:239412024-239412046 GTCCAGCGATGGAGGTCCTGAGG No data
948647067_948647069 -6 Left 948647067 2:239411996-239412018 CCAGACCTGAGTCAGTTCTCAGC No data
Right 948647069 2:239412013-239412035 CTCAGCCACCAGTCCAGCGATGG No data
948647067_948647070 -3 Left 948647067 2:239411996-239412018 CCAGACCTGAGTCAGTTCTCAGC No data
Right 948647070 2:239412016-239412038 AGCCACCAGTCCAGCGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948647067 Original CRISPR GCTGAGAACTGACTCAGGTC TGG (reversed) Intergenic
No off target data available for this crispr