ID: 948647068

View in Genome Browser
Species Human (GRCh38)
Location 2:239412001-239412023
Sequence TGGTGGCTGAGAACTGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948647068_948647073 0 Left 948647068 2:239412001-239412023 CCTGAGTCAGTTCTCAGCCACCA No data
Right 948647073 2:239412024-239412046 GTCCAGCGATGGAGGTCCTGAGG No data
948647068_948647070 -8 Left 948647068 2:239412001-239412023 CCTGAGTCAGTTCTCAGCCACCA No data
Right 948647070 2:239412016-239412038 AGCCACCAGTCCAGCGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948647068 Original CRISPR TGGTGGCTGAGAACTGACTC AGG (reversed) Intergenic
No off target data available for this crispr