ID: 948647069

View in Genome Browser
Species Human (GRCh38)
Location 2:239412013-239412035
Sequence CTCAGCCACCAGTCCAGCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948647067_948647069 -6 Left 948647067 2:239411996-239412018 CCAGACCTGAGTCAGTTCTCAGC No data
Right 948647069 2:239412013-239412035 CTCAGCCACCAGTCCAGCGATGG No data
948647064_948647069 7 Left 948647064 2:239411983-239412005 CCTCACCCAATGGCCAGACCTGA No data
Right 948647069 2:239412013-239412035 CTCAGCCACCAGTCCAGCGATGG No data
948647066_948647069 1 Left 948647066 2:239411989-239412011 CCAATGGCCAGACCTGAGTCAGT No data
Right 948647069 2:239412013-239412035 CTCAGCCACCAGTCCAGCGATGG No data
948647062_948647069 9 Left 948647062 2:239411981-239412003 CCCCTCACCCAATGGCCAGACCT No data
Right 948647069 2:239412013-239412035 CTCAGCCACCAGTCCAGCGATGG No data
948647063_948647069 8 Left 948647063 2:239411982-239412004 CCCTCACCCAATGGCCAGACCTG No data
Right 948647069 2:239412013-239412035 CTCAGCCACCAGTCCAGCGATGG No data
948647065_948647069 2 Left 948647065 2:239411988-239412010 CCCAATGGCCAGACCTGAGTCAG No data
Right 948647069 2:239412013-239412035 CTCAGCCACCAGTCCAGCGATGG No data
948647060_948647069 27 Left 948647060 2:239411963-239411985 CCACAAGGAAAATCACAACCCCT No data
Right 948647069 2:239412013-239412035 CTCAGCCACCAGTCCAGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948647069 Original CRISPR CTCAGCCACCAGTCCAGCGA TGG Intergenic
No off target data available for this crispr