ID: 948647073

View in Genome Browser
Species Human (GRCh38)
Location 2:239412024-239412046
Sequence GTCCAGCGATGGAGGTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948647067_948647073 5 Left 948647067 2:239411996-239412018 CCAGACCTGAGTCAGTTCTCAGC No data
Right 948647073 2:239412024-239412046 GTCCAGCGATGGAGGTCCTGAGG No data
948647063_948647073 19 Left 948647063 2:239411982-239412004 CCCTCACCCAATGGCCAGACCTG No data
Right 948647073 2:239412024-239412046 GTCCAGCGATGGAGGTCCTGAGG No data
948647064_948647073 18 Left 948647064 2:239411983-239412005 CCTCACCCAATGGCCAGACCTGA No data
Right 948647073 2:239412024-239412046 GTCCAGCGATGGAGGTCCTGAGG No data
948647068_948647073 0 Left 948647068 2:239412001-239412023 CCTGAGTCAGTTCTCAGCCACCA No data
Right 948647073 2:239412024-239412046 GTCCAGCGATGGAGGTCCTGAGG No data
948647065_948647073 13 Left 948647065 2:239411988-239412010 CCCAATGGCCAGACCTGAGTCAG No data
Right 948647073 2:239412024-239412046 GTCCAGCGATGGAGGTCCTGAGG No data
948647062_948647073 20 Left 948647062 2:239411981-239412003 CCCCTCACCCAATGGCCAGACCT No data
Right 948647073 2:239412024-239412046 GTCCAGCGATGGAGGTCCTGAGG No data
948647066_948647073 12 Left 948647066 2:239411989-239412011 CCAATGGCCAGACCTGAGTCAGT No data
Right 948647073 2:239412024-239412046 GTCCAGCGATGGAGGTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948647073 Original CRISPR GTCCAGCGATGGAGGTCCTG AGG Intergenic
No off target data available for this crispr