ID: 948647126

View in Genome Browser
Species Human (GRCh38)
Location 2:239412373-239412395
Sequence CTGAAATCAAGGCGTCGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948647120_948647126 12 Left 948647120 2:239412338-239412360 CCAGGAGTCTGGGTCCTCTGTGC No data
Right 948647126 2:239412373-239412395 CTGAAATCAAGGCGTCGGTCAGG No data
948647119_948647126 19 Left 948647119 2:239412331-239412353 CCGTGGGCCAGGAGTCTGGGTCC No data
Right 948647126 2:239412373-239412395 CTGAAATCAAGGCGTCGGTCAGG No data
948647122_948647126 -2 Left 948647122 2:239412352-239412374 CCTCTGTGCAGTCTCACCAGGCT No data
Right 948647126 2:239412373-239412395 CTGAAATCAAGGCGTCGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948647126 Original CRISPR CTGAAATCAAGGCGTCGGTC AGG Intergenic
No off target data available for this crispr