ID: 948647898

View in Genome Browser
Species Human (GRCh38)
Location 2:239420152-239420174
Sequence GGTAGGACCTTCAAGAGCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948647898_948647903 25 Left 948647898 2:239420152-239420174 CCGTTGCTCTTGAAGGTCCTACC No data
Right 948647903 2:239420200-239420222 TCGTTCCTACAGAGCACAGTCGG No data
948647898_948647904 26 Left 948647898 2:239420152-239420174 CCGTTGCTCTTGAAGGTCCTACC No data
Right 948647904 2:239420201-239420223 CGTTCCTACAGAGCACAGTCGGG No data
948647898_948647906 30 Left 948647898 2:239420152-239420174 CCGTTGCTCTTGAAGGTCCTACC No data
Right 948647906 2:239420205-239420227 CCTACAGAGCACAGTCGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948647898 Original CRISPR GGTAGGACCTTCAAGAGCAA CGG (reversed) Intergenic
No off target data available for this crispr