ID: 948648324

View in Genome Browser
Species Human (GRCh38)
Location 2:239423026-239423048
Sequence ACCAGGAAGTGGCAGGTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948648319_948648324 -10 Left 948648319 2:239423013-239423035 CCAAACTCACATGACCAGGAAGT No data
Right 948648324 2:239423026-239423048 ACCAGGAAGTGGCAGGTCAGGGG No data
948648317_948648324 -8 Left 948648317 2:239423011-239423033 CCCCAAACTCACATGACCAGGAA No data
Right 948648324 2:239423026-239423048 ACCAGGAAGTGGCAGGTCAGGGG No data
948648315_948648324 15 Left 948648315 2:239422988-239423010 CCACTCAGAGACTCTGGGCAGCT No data
Right 948648324 2:239423026-239423048 ACCAGGAAGTGGCAGGTCAGGGG No data
948648318_948648324 -9 Left 948648318 2:239423012-239423034 CCCAAACTCACATGACCAGGAAG No data
Right 948648324 2:239423026-239423048 ACCAGGAAGTGGCAGGTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948648324 Original CRISPR ACCAGGAAGTGGCAGGTCAG GGG Intergenic
No off target data available for this crispr