ID: 948653320

View in Genome Browser
Species Human (GRCh38)
Location 2:239462453-239462475
Sequence CCCCGGTTCCGGAGTTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948653320_948653328 24 Left 948653320 2:239462453-239462475 CCCAGGGAACTCCGGAACCGGGG No data
Right 948653328 2:239462500-239462522 AACATCTCCATTTCATTTTCTGG No data
948653320_948653327 1 Left 948653320 2:239462453-239462475 CCCAGGGAACTCCGGAACCGGGG No data
Right 948653327 2:239462477-239462499 CCTCATCTGGCGTGAAGAGCAGG No data
948653320_948653329 25 Left 948653320 2:239462453-239462475 CCCAGGGAACTCCGGAACCGGGG No data
Right 948653329 2:239462501-239462523 ACATCTCCATTTCATTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948653320 Original CRISPR CCCCGGTTCCGGAGTTCCCT GGG (reversed) Intergenic