ID: 948653327

View in Genome Browser
Species Human (GRCh38)
Location 2:239462477-239462499
Sequence CCTCATCTGGCGTGAAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948653311_948653327 24 Left 948653311 2:239462430-239462452 CCCACTCACTGGTCTTGTCCTGG No data
Right 948653327 2:239462477-239462499 CCTCATCTGGCGTGAAGAGCAGG No data
948653322_948653327 0 Left 948653322 2:239462454-239462476 CCAGGGAACTCCGGAACCGGGGT No data
Right 948653327 2:239462477-239462499 CCTCATCTGGCGTGAAGAGCAGG No data
948653323_948653327 -10 Left 948653323 2:239462464-239462486 CCGGAACCGGGGTCCTCATCTGG No data
Right 948653327 2:239462477-239462499 CCTCATCTGGCGTGAAGAGCAGG No data
948653313_948653327 23 Left 948653313 2:239462431-239462453 CCACTCACTGGTCTTGTCCTGGC No data
Right 948653327 2:239462477-239462499 CCTCATCTGGCGTGAAGAGCAGG No data
948653317_948653327 6 Left 948653317 2:239462448-239462470 CCTGGCCCAGGGAACTCCGGAAC No data
Right 948653327 2:239462477-239462499 CCTCATCTGGCGTGAAGAGCAGG No data
948653320_948653327 1 Left 948653320 2:239462453-239462475 CCCAGGGAACTCCGGAACCGGGG No data
Right 948653327 2:239462477-239462499 CCTCATCTGGCGTGAAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948653327 Original CRISPR CCTCATCTGGCGTGAAGAGC AGG Intergenic
No off target data available for this crispr