ID: 948653328

View in Genome Browser
Species Human (GRCh38)
Location 2:239462500-239462522
Sequence AACATCTCCATTTCATTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948653317_948653328 29 Left 948653317 2:239462448-239462470 CCTGGCCCAGGGAACTCCGGAAC No data
Right 948653328 2:239462500-239462522 AACATCTCCATTTCATTTTCTGG No data
948653323_948653328 13 Left 948653323 2:239462464-239462486 CCGGAACCGGGGTCCTCATCTGG No data
Right 948653328 2:239462500-239462522 AACATCTCCATTTCATTTTCTGG No data
948653320_948653328 24 Left 948653320 2:239462453-239462475 CCCAGGGAACTCCGGAACCGGGG No data
Right 948653328 2:239462500-239462522 AACATCTCCATTTCATTTTCTGG No data
948653322_948653328 23 Left 948653322 2:239462454-239462476 CCAGGGAACTCCGGAACCGGGGT No data
Right 948653328 2:239462500-239462522 AACATCTCCATTTCATTTTCTGG No data
948653325_948653328 7 Left 948653325 2:239462470-239462492 CCGGGGTCCTCATCTGGCGTGAA No data
Right 948653328 2:239462500-239462522 AACATCTCCATTTCATTTTCTGG No data
948653326_948653328 0 Left 948653326 2:239462477-239462499 CCTCATCTGGCGTGAAGAGCAGG No data
Right 948653328 2:239462500-239462522 AACATCTCCATTTCATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948653328 Original CRISPR AACATCTCCATTTCATTTTC TGG Intergenic
No off target data available for this crispr