ID: 948656458

View in Genome Browser
Species Human (GRCh38)
Location 2:239479579-239479601
Sequence GGGACCCTGTGGTGACTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948656458_948656470 22 Left 948656458 2:239479579-239479601 CCTCTCAGTCACCACAGGGTCCC No data
Right 948656470 2:239479624-239479646 TCCTGCTCTCTGTCTCCGGATGG No data
948656458_948656473 24 Left 948656458 2:239479579-239479601 CCTCTCAGTCACCACAGGGTCCC No data
Right 948656473 2:239479626-239479648 CTGCTCTCTGTCTCCGGATGGGG No data
948656458_948656469 18 Left 948656458 2:239479579-239479601 CCTCTCAGTCACCACAGGGTCCC No data
Right 948656469 2:239479620-239479642 CCTCTCCTGCTCTCTGTCTCCGG No data
948656458_948656472 23 Left 948656458 2:239479579-239479601 CCTCTCAGTCACCACAGGGTCCC No data
Right 948656472 2:239479625-239479647 CCTGCTCTCTGTCTCCGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948656458 Original CRISPR GGGACCCTGTGGTGACTGAG AGG (reversed) Intergenic