ID: 948656485

View in Genome Browser
Species Human (GRCh38)
Location 2:239479678-239479700
Sequence GTCAGGCCCCATGCTGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948656485_948656494 12 Left 948656485 2:239479678-239479700 CCATCTTCAGCATGGGGCCTGAC No data
Right 948656494 2:239479713-239479735 AGGAGGTTGGGGATCTTGCAAGG No data
948656485_948656488 -8 Left 948656485 2:239479678-239479700 CCATCTTCAGCATGGGGCCTGAC No data
Right 948656488 2:239479693-239479715 GGCCTGACTCAGGGTGCATGAGG No data
948656485_948656496 16 Left 948656485 2:239479678-239479700 CCATCTTCAGCATGGGGCCTGAC No data
Right 948656496 2:239479717-239479739 GGTTGGGGATCTTGCAAGGTGGG No data
948656485_948656490 -5 Left 948656485 2:239479678-239479700 CCATCTTCAGCATGGGGCCTGAC No data
Right 948656490 2:239479696-239479718 CTGACTCAGGGTGCATGAGGAGG No data
948656485_948656491 -1 Left 948656485 2:239479678-239479700 CCATCTTCAGCATGGGGCCTGAC No data
Right 948656491 2:239479700-239479722 CTCAGGGTGCATGAGGAGGTTGG No data
948656485_948656492 0 Left 948656485 2:239479678-239479700 CCATCTTCAGCATGGGGCCTGAC No data
Right 948656492 2:239479701-239479723 TCAGGGTGCATGAGGAGGTTGGG No data
948656485_948656493 1 Left 948656485 2:239479678-239479700 CCATCTTCAGCATGGGGCCTGAC No data
Right 948656493 2:239479702-239479724 CAGGGTGCATGAGGAGGTTGGGG No data
948656485_948656495 15 Left 948656485 2:239479678-239479700 CCATCTTCAGCATGGGGCCTGAC No data
Right 948656495 2:239479716-239479738 AGGTTGGGGATCTTGCAAGGTGG No data
948656485_948656497 17 Left 948656485 2:239479678-239479700 CCATCTTCAGCATGGGGCCTGAC No data
Right 948656497 2:239479718-239479740 GTTGGGGATCTTGCAAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948656485 Original CRISPR GTCAGGCCCCATGCTGAAGA TGG (reversed) Intergenic
No off target data available for this crispr