ID: 948656489

View in Genome Browser
Species Human (GRCh38)
Location 2:239479695-239479717
Sequence CTCCTCATGCACCCTGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948656489_948656497 0 Left 948656489 2:239479695-239479717 CCTGACTCAGGGTGCATGAGGAG No data
Right 948656497 2:239479718-239479740 GTTGGGGATCTTGCAAGGTGGGG No data
948656489_948656495 -2 Left 948656489 2:239479695-239479717 CCTGACTCAGGGTGCATGAGGAG No data
Right 948656495 2:239479716-239479738 AGGTTGGGGATCTTGCAAGGTGG No data
948656489_948656496 -1 Left 948656489 2:239479695-239479717 CCTGACTCAGGGTGCATGAGGAG No data
Right 948656496 2:239479717-239479739 GGTTGGGGATCTTGCAAGGTGGG No data
948656489_948656494 -5 Left 948656489 2:239479695-239479717 CCTGACTCAGGGTGCATGAGGAG No data
Right 948656494 2:239479713-239479735 AGGAGGTTGGGGATCTTGCAAGG No data
948656489_948656498 14 Left 948656489 2:239479695-239479717 CCTGACTCAGGGTGCATGAGGAG No data
Right 948656498 2:239479732-239479754 AAGGTGGGGAATCTATGTCTTGG No data
948656489_948656499 17 Left 948656489 2:239479695-239479717 CCTGACTCAGGGTGCATGAGGAG No data
Right 948656499 2:239479735-239479757 GTGGGGAATCTATGTCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948656489 Original CRISPR CTCCTCATGCACCCTGAGTC AGG (reversed) Intergenic
No off target data available for this crispr