ID: 948656494

View in Genome Browser
Species Human (GRCh38)
Location 2:239479713-239479735
Sequence AGGAGGTTGGGGATCTTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948656489_948656494 -5 Left 948656489 2:239479695-239479717 CCTGACTCAGGGTGCATGAGGAG No data
Right 948656494 2:239479713-239479735 AGGAGGTTGGGGATCTTGCAAGG No data
948656485_948656494 12 Left 948656485 2:239479678-239479700 CCATCTTCAGCATGGGGCCTGAC No data
Right 948656494 2:239479713-239479735 AGGAGGTTGGGGATCTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948656494 Original CRISPR AGGAGGTTGGGGATCTTGCA AGG Intergenic
No off target data available for this crispr