ID: 948656497

View in Genome Browser
Species Human (GRCh38)
Location 2:239479718-239479740
Sequence GTTGGGGATCTTGCAAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948656485_948656497 17 Left 948656485 2:239479678-239479700 CCATCTTCAGCATGGGGCCTGAC No data
Right 948656497 2:239479718-239479740 GTTGGGGATCTTGCAAGGTGGGG No data
948656489_948656497 0 Left 948656489 2:239479695-239479717 CCTGACTCAGGGTGCATGAGGAG No data
Right 948656497 2:239479718-239479740 GTTGGGGATCTTGCAAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948656497 Original CRISPR GTTGGGGATCTTGCAAGGTG GGG Intergenic
No off target data available for this crispr