ID: 948656498

View in Genome Browser
Species Human (GRCh38)
Location 2:239479732-239479754
Sequence AAGGTGGGGAATCTATGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948656489_948656498 14 Left 948656489 2:239479695-239479717 CCTGACTCAGGGTGCATGAGGAG No data
Right 948656498 2:239479732-239479754 AAGGTGGGGAATCTATGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948656498 Original CRISPR AAGGTGGGGAATCTATGTCT TGG Intergenic
No off target data available for this crispr