ID: 948659494

View in Genome Browser
Species Human (GRCh38)
Location 2:239498371-239498393
Sequence CACATGTGGAACTATGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948659494_948659498 0 Left 948659494 2:239498371-239498393 CCCAGATCATAGTTCCACATGTG No data
Right 948659498 2:239498394-239498416 ACGTAAATGTAAACAATTGGAGG No data
948659494_948659505 27 Left 948659494 2:239498371-239498393 CCCAGATCATAGTTCCACATGTG No data
Right 948659505 2:239498421-239498443 CGGGGAGCTGGCTCTGCTCGGGG 0: 2
1: 0
2: 2
3: 26
4: 505
948659494_948659504 26 Left 948659494 2:239498371-239498393 CCCAGATCATAGTTCCACATGTG No data
Right 948659504 2:239498420-239498442 TCGGGGAGCTGGCTCTGCTCGGG No data
948659494_948659497 -3 Left 948659494 2:239498371-239498393 CCCAGATCATAGTTCCACATGTG No data
Right 948659497 2:239498391-239498413 GTGACGTAAATGTAAACAATTGG No data
948659494_948659503 25 Left 948659494 2:239498371-239498393 CCCAGATCATAGTTCCACATGTG No data
Right 948659503 2:239498419-239498441 TTCGGGGAGCTGGCTCTGCTCGG No data
948659494_948659501 9 Left 948659494 2:239498371-239498393 CCCAGATCATAGTTCCACATGTG No data
Right 948659501 2:239498403-239498425 TAAACAATTGGAGGACTTCGGGG No data
948659494_948659502 15 Left 948659494 2:239498371-239498393 CCCAGATCATAGTTCCACATGTG No data
Right 948659502 2:239498409-239498431 ATTGGAGGACTTCGGGGAGCTGG No data
948659494_948659500 8 Left 948659494 2:239498371-239498393 CCCAGATCATAGTTCCACATGTG No data
Right 948659500 2:239498402-239498424 GTAAACAATTGGAGGACTTCGGG No data
948659494_948659499 7 Left 948659494 2:239498371-239498393 CCCAGATCATAGTTCCACATGTG No data
Right 948659499 2:239498401-239498423 TGTAAACAATTGGAGGACTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948659494 Original CRISPR CACATGTGGAACTATGATCT GGG (reversed) Intergenic
No off target data available for this crispr