ID: 948663254

View in Genome Browser
Species Human (GRCh38)
Location 2:239519691-239519713
Sequence GCTGCTTGCATTTACCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948663244_948663254 26 Left 948663244 2:239519642-239519664 CCCCTTTTAGAAGGGAAGGCCAG No data
Right 948663254 2:239519691-239519713 GCTGCTTGCATTTACCATGTTGG No data
948663246_948663254 24 Left 948663246 2:239519644-239519666 CCTTTTAGAAGGGAAGGCCAGAG No data
Right 948663254 2:239519691-239519713 GCTGCTTGCATTTACCATGTTGG No data
948663245_948663254 25 Left 948663245 2:239519643-239519665 CCCTTTTAGAAGGGAAGGCCAGA No data
Right 948663254 2:239519691-239519713 GCTGCTTGCATTTACCATGTTGG No data
948663251_948663254 7 Left 948663251 2:239519661-239519683 CCAGAGGCGGCTGGCGGCTCCTT No data
Right 948663254 2:239519691-239519713 GCTGCTTGCATTTACCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948663254 Original CRISPR GCTGCTTGCATTTACCATGT TGG Intergenic
No off target data available for this crispr