ID: 948663570

View in Genome Browser
Species Human (GRCh38)
Location 2:239521149-239521171
Sequence CATCCCTGCTGAGGGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948663570_948663584 20 Left 948663570 2:239521149-239521171 CCACCCAGCCCTCAGCAGGGATG No data
Right 948663584 2:239521192-239521214 AGGGTGTGTTGCGTTGTCCTGGG No data
948663570_948663585 28 Left 948663570 2:239521149-239521171 CCACCCAGCCCTCAGCAGGGATG No data
Right 948663585 2:239521200-239521222 TTGCGTTGTCCTGGGAGCCAAGG No data
948663570_948663578 0 Left 948663570 2:239521149-239521171 CCACCCAGCCCTCAGCAGGGATG No data
Right 948663578 2:239521172-239521194 TCTGTCCACAGGGACCCTGGAGG No data
948663570_948663583 19 Left 948663570 2:239521149-239521171 CCACCCAGCCCTCAGCAGGGATG No data
Right 948663583 2:239521191-239521213 GAGGGTGTGTTGCGTTGTCCTGG No data
948663570_948663579 1 Left 948663570 2:239521149-239521171 CCACCCAGCCCTCAGCAGGGATG No data
Right 948663579 2:239521173-239521195 CTGTCCACAGGGACCCTGGAGGG No data
948663570_948663577 -3 Left 948663570 2:239521149-239521171 CCACCCAGCCCTCAGCAGGGATG No data
Right 948663577 2:239521169-239521191 ATGTCTGTCCACAGGGACCCTGG No data
948663570_948663576 -10 Left 948663570 2:239521149-239521171 CCACCCAGCCCTCAGCAGGGATG No data
Right 948663576 2:239521162-239521184 AGCAGGGATGTCTGTCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948663570 Original CRISPR CATCCCTGCTGAGGGCTGGG TGG (reversed) Intergenic
No off target data available for this crispr