ID: 948663576

View in Genome Browser
Species Human (GRCh38)
Location 2:239521162-239521184
Sequence AGCAGGGATGTCTGTCCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948663570_948663576 -10 Left 948663570 2:239521149-239521171 CCACCCAGCCCTCAGCAGGGATG No data
Right 948663576 2:239521162-239521184 AGCAGGGATGTCTGTCCACAGGG No data
948663568_948663576 -8 Left 948663568 2:239521147-239521169 CCCCACCCAGCCCTCAGCAGGGA No data
Right 948663576 2:239521162-239521184 AGCAGGGATGTCTGTCCACAGGG No data
948663569_948663576 -9 Left 948663569 2:239521148-239521170 CCCACCCAGCCCTCAGCAGGGAT No data
Right 948663576 2:239521162-239521184 AGCAGGGATGTCTGTCCACAGGG No data
948663565_948663576 0 Left 948663565 2:239521139-239521161 CCTTTCTTCCCCACCCAGCCCTC No data
Right 948663576 2:239521162-239521184 AGCAGGGATGTCTGTCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948663576 Original CRISPR AGCAGGGATGTCTGTCCACA GGG Intergenic
No off target data available for this crispr