ID: 948664127

View in Genome Browser
Species Human (GRCh38)
Location 2:239523919-239523941
Sequence GGTTTGGGATCAGGTAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948664127_948664134 8 Left 948664127 2:239523919-239523941 CCCTGTCTACCTGATCCCAAACC No data
Right 948664134 2:239523950-239523972 CCTTTTCCAGAAGCAGAATGAGG No data
948664127_948664138 25 Left 948664127 2:239523919-239523941 CCCTGTCTACCTGATCCCAAACC No data
Right 948664138 2:239523967-239523989 ATGAGGTTGGACCTGTGTTAGGG No data
948664127_948664139 26 Left 948664127 2:239523919-239523941 CCCTGTCTACCTGATCCCAAACC No data
Right 948664139 2:239523968-239523990 TGAGGTTGGACCTGTGTTAGGGG No data
948664127_948664137 24 Left 948664127 2:239523919-239523941 CCCTGTCTACCTGATCCCAAACC No data
Right 948664137 2:239523966-239523988 AATGAGGTTGGACCTGTGTTAGG No data
948664127_948664135 12 Left 948664127 2:239523919-239523941 CCCTGTCTACCTGATCCCAAACC No data
Right 948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948664127 Original CRISPR GGTTTGGGATCAGGTAGACA GGG (reversed) Intergenic
No off target data available for this crispr