ID: 948664128

View in Genome Browser
Species Human (GRCh38)
Location 2:239523920-239523942
Sequence TGGTTTGGGATCAGGTAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948664128_948664138 24 Left 948664128 2:239523920-239523942 CCTGTCTACCTGATCCCAAACCA No data
Right 948664138 2:239523967-239523989 ATGAGGTTGGACCTGTGTTAGGG No data
948664128_948664134 7 Left 948664128 2:239523920-239523942 CCTGTCTACCTGATCCCAAACCA No data
Right 948664134 2:239523950-239523972 CCTTTTCCAGAAGCAGAATGAGG No data
948664128_948664139 25 Left 948664128 2:239523920-239523942 CCTGTCTACCTGATCCCAAACCA No data
Right 948664139 2:239523968-239523990 TGAGGTTGGACCTGTGTTAGGGG No data
948664128_948664135 11 Left 948664128 2:239523920-239523942 CCTGTCTACCTGATCCCAAACCA No data
Right 948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG No data
948664128_948664137 23 Left 948664128 2:239523920-239523942 CCTGTCTACCTGATCCCAAACCA No data
Right 948664137 2:239523966-239523988 AATGAGGTTGGACCTGTGTTAGG No data
948664128_948664140 30 Left 948664128 2:239523920-239523942 CCTGTCTACCTGATCCCAAACCA No data
Right 948664140 2:239523973-239523995 TTGGACCTGTGTTAGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948664128 Original CRISPR TGGTTTGGGATCAGGTAGAC AGG (reversed) Intergenic
No off target data available for this crispr