ID: 948664129

View in Genome Browser
Species Human (GRCh38)
Location 2:239523928-239523950
Sequence GAAAAGAATGGTTTGGGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948664129_948664137 15 Left 948664129 2:239523928-239523950 CCTGATCCCAAACCATTCTTTTC No data
Right 948664137 2:239523966-239523988 AATGAGGTTGGACCTGTGTTAGG No data
948664129_948664139 17 Left 948664129 2:239523928-239523950 CCTGATCCCAAACCATTCTTTTC No data
Right 948664139 2:239523968-239523990 TGAGGTTGGACCTGTGTTAGGGG No data
948664129_948664138 16 Left 948664129 2:239523928-239523950 CCTGATCCCAAACCATTCTTTTC No data
Right 948664138 2:239523967-239523989 ATGAGGTTGGACCTGTGTTAGGG No data
948664129_948664140 22 Left 948664129 2:239523928-239523950 CCTGATCCCAAACCATTCTTTTC No data
Right 948664140 2:239523973-239523995 TTGGACCTGTGTTAGGGGCATGG No data
948664129_948664134 -1 Left 948664129 2:239523928-239523950 CCTGATCCCAAACCATTCTTTTC No data
Right 948664134 2:239523950-239523972 CCTTTTCCAGAAGCAGAATGAGG No data
948664129_948664141 25 Left 948664129 2:239523928-239523950 CCTGATCCCAAACCATTCTTTTC No data
Right 948664141 2:239523976-239523998 GACCTGTGTTAGGGGCATGGAGG No data
948664129_948664135 3 Left 948664129 2:239523928-239523950 CCTGATCCCAAACCATTCTTTTC No data
Right 948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948664129 Original CRISPR GAAAAGAATGGTTTGGGATC AGG (reversed) Intergenic
No off target data available for this crispr