ID: 948664130

View in Genome Browser
Species Human (GRCh38)
Location 2:239523934-239523956
Sequence GAAAAGGAAAAGAATGGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948664130_948664139 11 Left 948664130 2:239523934-239523956 CCCAAACCATTCTTTTCCTTTTC No data
Right 948664139 2:239523968-239523990 TGAGGTTGGACCTGTGTTAGGGG No data
948664130_948664141 19 Left 948664130 2:239523934-239523956 CCCAAACCATTCTTTTCCTTTTC No data
Right 948664141 2:239523976-239523998 GACCTGTGTTAGGGGCATGGAGG No data
948664130_948664135 -3 Left 948664130 2:239523934-239523956 CCCAAACCATTCTTTTCCTTTTC No data
Right 948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG No data
948664130_948664140 16 Left 948664130 2:239523934-239523956 CCCAAACCATTCTTTTCCTTTTC No data
Right 948664140 2:239523973-239523995 TTGGACCTGTGTTAGGGGCATGG No data
948664130_948664138 10 Left 948664130 2:239523934-239523956 CCCAAACCATTCTTTTCCTTTTC No data
Right 948664138 2:239523967-239523989 ATGAGGTTGGACCTGTGTTAGGG No data
948664130_948664134 -7 Left 948664130 2:239523934-239523956 CCCAAACCATTCTTTTCCTTTTC No data
Right 948664134 2:239523950-239523972 CCTTTTCCAGAAGCAGAATGAGG No data
948664130_948664137 9 Left 948664130 2:239523934-239523956 CCCAAACCATTCTTTTCCTTTTC No data
Right 948664137 2:239523966-239523988 AATGAGGTTGGACCTGTGTTAGG No data
948664130_948664143 28 Left 948664130 2:239523934-239523956 CCCAAACCATTCTTTTCCTTTTC No data
Right 948664143 2:239523985-239524007 TAGGGGCATGGAGGCCAGCCTGG No data
948664130_948664144 29 Left 948664130 2:239523934-239523956 CCCAAACCATTCTTTTCCTTTTC No data
Right 948664144 2:239523986-239524008 AGGGGCATGGAGGCCAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948664130 Original CRISPR GAAAAGGAAAAGAATGGTTT GGG (reversed) Intergenic
No off target data available for this crispr