ID: 948664135

View in Genome Browser
Species Human (GRCh38)
Location 2:239523954-239523976
Sequence TTCCAGAAGCAGAATGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948664127_948664135 12 Left 948664127 2:239523919-239523941 CCCTGTCTACCTGATCCCAAACC No data
Right 948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG No data
948664128_948664135 11 Left 948664128 2:239523920-239523942 CCTGTCTACCTGATCCCAAACCA No data
Right 948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG No data
948664131_948664135 -4 Left 948664131 2:239523935-239523957 CCAAACCATTCTTTTCCTTTTCC No data
Right 948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG No data
948664130_948664135 -3 Left 948664130 2:239523934-239523956 CCCAAACCATTCTTTTCCTTTTC No data
Right 948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG No data
948664132_948664135 -9 Left 948664132 2:239523940-239523962 CCATTCTTTTCCTTTTCCAGAAG No data
Right 948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG No data
948664129_948664135 3 Left 948664129 2:239523928-239523950 CCTGATCCCAAACCATTCTTTTC No data
Right 948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948664135 Original CRISPR TTCCAGAAGCAGAATGAGGT TGG Intergenic
No off target data available for this crispr