ID: 948664427

View in Genome Browser
Species Human (GRCh38)
Location 2:239526194-239526216
Sequence GATCTCAGCAGCTCTCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948664427_948664431 1 Left 948664427 2:239526194-239526216 CCTGCTGGAGAGCTGCTGAGATC No data
Right 948664431 2:239526218-239526240 AGGTGCACGTGGACCTTCCCTGG No data
948664427_948664433 9 Left 948664427 2:239526194-239526216 CCTGCTGGAGAGCTGCTGAGATC No data
Right 948664433 2:239526226-239526248 GTGGACCTTCCCTGGAAGGATGG No data
948664427_948664435 15 Left 948664427 2:239526194-239526216 CCTGCTGGAGAGCTGCTGAGATC No data
Right 948664435 2:239526232-239526254 CTTCCCTGGAAGGATGGTTCTGG No data
948664427_948664432 5 Left 948664427 2:239526194-239526216 CCTGCTGGAGAGCTGCTGAGATC No data
Right 948664432 2:239526222-239526244 GCACGTGGACCTTCCCTGGAAGG No data
948664427_948664429 -10 Left 948664427 2:239526194-239526216 CCTGCTGGAGAGCTGCTGAGATC No data
Right 948664429 2:239526207-239526229 TGCTGAGATCCAGGTGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948664427 Original CRISPR GATCTCAGCAGCTCTCCAGC AGG (reversed) Intergenic
No off target data available for this crispr