ID: 948668426

View in Genome Browser
Species Human (GRCh38)
Location 2:239551000-239551022
Sequence GATGACGCAGCCTCCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948668426_948668430 14 Left 948668426 2:239551000-239551022 CCACCTGGGGAGGCTGCGTCATC No data
Right 948668430 2:239551037-239551059 GAGAGTCATTACAAGTTCAAAGG No data
948668426_948668431 15 Left 948668426 2:239551000-239551022 CCACCTGGGGAGGCTGCGTCATC No data
Right 948668431 2:239551038-239551060 AGAGTCATTACAAGTTCAAAGGG No data
948668426_948668429 -8 Left 948668426 2:239551000-239551022 CCACCTGGGGAGGCTGCGTCATC No data
Right 948668429 2:239551015-239551037 GCGTCATCTTCATGGTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948668426 Original CRISPR GATGACGCAGCCTCCCCAGG TGG (reversed) Intergenic
No off target data available for this crispr