ID: 948669954

View in Genome Browser
Species Human (GRCh38)
Location 2:239561848-239561870
Sequence GTGCTTGTCCTCAAGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948669954_948669958 -7 Left 948669954 2:239561848-239561870 CCCCATCACTTGAGGACAAGCAC No data
Right 948669958 2:239561864-239561886 CAAGCACGCATGAGTTGGCTTGG No data
948669954_948669960 5 Left 948669954 2:239561848-239561870 CCCCATCACTTGAGGACAAGCAC No data
Right 948669960 2:239561876-239561898 AGTTGGCTTGGGCTGCTGTGAGG No data
948669954_948669964 24 Left 948669954 2:239561848-239561870 CCCCATCACTTGAGGACAAGCAC No data
Right 948669964 2:239561895-239561917 GAGGAAGCACACAGGCTGGGCGG No data
948669954_948669962 20 Left 948669954 2:239561848-239561870 CCCCATCACTTGAGGACAAGCAC No data
Right 948669962 2:239561891-239561913 CTGTGAGGAAGCACACAGGCTGG No data
948669954_948669961 16 Left 948669954 2:239561848-239561870 CCCCATCACTTGAGGACAAGCAC No data
Right 948669961 2:239561887-239561909 GCTGCTGTGAGGAAGCACACAGG No data
948669954_948669959 -6 Left 948669954 2:239561848-239561870 CCCCATCACTTGAGGACAAGCAC No data
Right 948669959 2:239561865-239561887 AAGCACGCATGAGTTGGCTTGGG No data
948669954_948669963 21 Left 948669954 2:239561848-239561870 CCCCATCACTTGAGGACAAGCAC No data
Right 948669963 2:239561892-239561914 TGTGAGGAAGCACACAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948669954 Original CRISPR GTGCTTGTCCTCAAGTGATG GGG (reversed) Intergenic
No off target data available for this crispr