ID: 948670409

View in Genome Browser
Species Human (GRCh38)
Location 2:239564802-239564824
Sequence CCCGGAAAGAAGCTAGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948670409_948670418 28 Left 948670409 2:239564802-239564824 CCAGTGACTAGCTTCTTTCCGGG No data
Right 948670418 2:239564853-239564875 AAGATGGTGATCCAGAGCCCCGG No data
948670409_948670415 5 Left 948670409 2:239564802-239564824 CCAGTGACTAGCTTCTTTCCGGG No data
Right 948670415 2:239564830-239564852 TGCTCCAGCACAGAGATATTTGG No data
948670409_948670417 12 Left 948670409 2:239564802-239564824 CCAGTGACTAGCTTCTTTCCGGG No data
Right 948670417 2:239564837-239564859 GCACAGAGATATTTGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948670409 Original CRISPR CCCGGAAAGAAGCTAGTCAC TGG (reversed) Intergenic
No off target data available for this crispr