ID: 948674355

View in Genome Browser
Species Human (GRCh38)
Location 2:239588337-239588359
Sequence GTGGAGTTGGAGCCACTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948674355_948674364 8 Left 948674355 2:239588337-239588359 CCACGGAGTGGCTCCAACTCCAC No data
Right 948674364 2:239588368-239588390 GGCAGCAGGAACCCAGAGGACGG No data
948674355_948674363 4 Left 948674355 2:239588337-239588359 CCACGGAGTGGCTCCAACTCCAC No data
Right 948674363 2:239588364-239588386 GGGAGGCAGCAGGAACCCAGAGG No data
948674355_948674360 -6 Left 948674355 2:239588337-239588359 CCACGGAGTGGCTCCAACTCCAC No data
Right 948674360 2:239588354-239588376 CTCCACTCCAGGGAGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948674355 Original CRISPR GTGGAGTTGGAGCCACTCCG TGG (reversed) Intergenic