ID: 948675641

View in Genome Browser
Species Human (GRCh38)
Location 2:239594999-239595021
Sequence TCTGATGCACAGCAGGAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948675636_948675641 3 Left 948675636 2:239594973-239594995 CCATCTGTGTGCATTTTGGAGAG No data
Right 948675641 2:239594999-239595021 TCTGATGCACAGCAGGAGGGCGG No data
948675635_948675641 4 Left 948675635 2:239594972-239594994 CCCATCTGTGTGCATTTTGGAGA No data
Right 948675641 2:239594999-239595021 TCTGATGCACAGCAGGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948675641 Original CRISPR TCTGATGCACAGCAGGAGGG CGG Intergenic
No off target data available for this crispr