ID: 948675796

View in Genome Browser
Species Human (GRCh38)
Location 2:239595887-239595909
Sequence GACCCAATCCTTGTACCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948675785_948675796 20 Left 948675785 2:239595844-239595866 CCTGATGCCTCCTGTGTGATGTG No data
Right 948675796 2:239595887-239595909 GACCCAATCCTTGTACCCACGGG No data
948675792_948675796 10 Left 948675792 2:239595854-239595876 CCTGTGTGATGTGGGGGGCTCAG No data
Right 948675796 2:239595887-239595909 GACCCAATCCTTGTACCCACGGG No data
948675791_948675796 13 Left 948675791 2:239595851-239595873 CCTCCTGTGTGATGTGGGGGGCT No data
Right 948675796 2:239595887-239595909 GACCCAATCCTTGTACCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948675796 Original CRISPR GACCCAATCCTTGTACCCAC GGG Intergenic
No off target data available for this crispr