ID: 948675918

View in Genome Browser
Species Human (GRCh38)
Location 2:239596637-239596659
Sequence TTCCTCCTTCCTCATGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948675918_948675925 0 Left 948675918 2:239596637-239596659 CCTACCTCATGAGGAAGGAGGAA No data
Right 948675925 2:239596660-239596682 GGGACCAGGAACCATGGAACGGG No data
948675918_948675927 2 Left 948675918 2:239596637-239596659 CCTACCTCATGAGGAAGGAGGAA No data
Right 948675927 2:239596662-239596684 GACCAGGAACCATGGAACGGGGG No data
948675918_948675924 -1 Left 948675918 2:239596637-239596659 CCTACCTCATGAGGAAGGAGGAA No data
Right 948675924 2:239596659-239596681 AGGGACCAGGAACCATGGAACGG No data
948675918_948675926 1 Left 948675918 2:239596637-239596659 CCTACCTCATGAGGAAGGAGGAA No data
Right 948675926 2:239596661-239596683 GGACCAGGAACCATGGAACGGGG No data
948675918_948675929 6 Left 948675918 2:239596637-239596659 CCTACCTCATGAGGAAGGAGGAA No data
Right 948675929 2:239596666-239596688 AGGAACCATGGAACGGGGGCAGG No data
948675918_948675931 24 Left 948675918 2:239596637-239596659 CCTACCTCATGAGGAAGGAGGAA No data
Right 948675931 2:239596684-239596706 GCAGGCAGCCTCTTAGAAACTGG No data
948675918_948675923 -6 Left 948675918 2:239596637-239596659 CCTACCTCATGAGGAAGGAGGAA No data
Right 948675923 2:239596654-239596676 GAGGAAGGGACCAGGAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948675918 Original CRISPR TTCCTCCTTCCTCATGAGGT AGG (reversed) Intergenic
No off target data available for this crispr