ID: 948677729

View in Genome Browser
Species Human (GRCh38)
Location 2:239608894-239608916
Sequence AGGGGCCCTCTCCACGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948677726_948677729 -9 Left 948677726 2:239608880-239608902 CCGGTCACTGCCTGAGGGGCCCT No data
Right 948677729 2:239608894-239608916 AGGGGCCCTCTCCACGGAGAAGG No data
948677718_948677729 24 Left 948677718 2:239608847-239608869 CCGGGAACCCACACAAGTGAAAC No data
Right 948677729 2:239608894-239608916 AGGGGCCCTCTCCACGGAGAAGG No data
948677725_948677729 -8 Left 948677725 2:239608879-239608901 CCCGGTCACTGCCTGAGGGGCCC No data
Right 948677729 2:239608894-239608916 AGGGGCCCTCTCCACGGAGAAGG No data
948677719_948677729 17 Left 948677719 2:239608854-239608876 CCCACACAAGTGAAACAGTGTCG No data
Right 948677729 2:239608894-239608916 AGGGGCCCTCTCCACGGAGAAGG No data
948677720_948677729 16 Left 948677720 2:239608855-239608877 CCACACAAGTGAAACAGTGTCGC No data
Right 948677729 2:239608894-239608916 AGGGGCCCTCTCCACGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948677729 Original CRISPR AGGGGCCCTCTCCACGGAGA AGG Intergenic
No off target data available for this crispr