ID: 948684604

View in Genome Browser
Species Human (GRCh38)
Location 2:239662523-239662545
Sequence ATGGAGGAGCAGAGTGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948684604_948684610 -2 Left 948684604 2:239662523-239662545 CCCTCTCCACTCTGCTCCTCCAT No data
Right 948684610 2:239662544-239662566 ATTTCCTGTGCCTTTCCTGAGGG No data
948684604_948684614 27 Left 948684604 2:239662523-239662545 CCCTCTCCACTCTGCTCCTCCAT No data
Right 948684614 2:239662573-239662595 CTTACACCCAACACACGCCAAGG No data
948684604_948684615 28 Left 948684604 2:239662523-239662545 CCCTCTCCACTCTGCTCCTCCAT No data
Right 948684615 2:239662574-239662596 TTACACCCAACACACGCCAAGGG No data
948684604_948684609 -3 Left 948684604 2:239662523-239662545 CCCTCTCCACTCTGCTCCTCCAT No data
Right 948684609 2:239662543-239662565 CATTTCCTGTGCCTTTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948684604 Original CRISPR ATGGAGGAGCAGAGTGGAGA GGG (reversed) Intergenic
No off target data available for this crispr